1: J Bacteriol. 2005 May;187(10):3329-38. 

Transcription activation in vitro by the Bradyrhizobium japonicum regulatory
protein FixK2.

Mesa S, Ucurum Z, Hennecke H, Fischer HM.

Institute of Microbiology, Eidgenossische Technische Hochschule, CH-8093 Zurich,
Switzerland. mesam@micro.biol.ethz.ch

In Bradyrhizobium japonicum, the N2-fixing root nodule endosymbiont of soybean,
a group of genes required for microaerobic, anaerobic, or symbiotic growth is
controlled by FixK2, a key regulator that is part of the FixLJ-FixK2 cascade.
FixK2 belongs to the family of cyclic AMP receptor protein/fumarate and nitrate
reductase (CRP/FNR) transcription factors that recognize a palindromic DNA motif
(CRP/FNR box) associated with the regulated promoters. Here, we report on a
biochemical analysis of FixK2 and its transcription activation activity in
vitro. FixK2 was expressed in Escherichia coli and purified as a soluble
N-terminally histidine-tagged protein. Gel filtration experiments revealed that
increasing the protein concentration shifts the monomer-dimer equilibrium toward
the dimer. Purified FixK2 productively interacted with the B. japonicum
sigma80-RNA polymerase holoenzyme, but not with E. coli sigma70-RNA polymerase
holoenzyme, to activate transcription from the B. japonicum fixNOQP, fixGHIS,
and hemN2 promoters in vitro. Furthermore, FixK2 activated transcription from
the E. coli FF(-41.5) model promoter, again only in concert with B. japonicum
RNA polymerase. All of these promoters are so-called class II CRP/FNR-type
promoters. We showed by specific mutagenesis that the FixK2 box at nucleotide
position -40.5 in the hemN2 promoter, but not that at -78.5, is crucial for
activation both in vivo and in vitro, which argues against recognition of a
potential class III promoter. Given the lack of any evidence for the presence of
a cofactor in purified FixK2, we surmise that FixK2 alone is sufficient to
activate in vitro transcription to at least a basal level. This contrasts with
all well-studied CRP/FNR-type proteins, which do require coregulators.

PMID: 15866917 [PubMed - indexed for MEDLINE]

2: J Bacteriol. 2005 May;187(9):3171-9. 

Impact of global transcriptional regulation by ArcA, ArcB, Cra, Crp, Cya, Fnr,
and Mlc on glucose catabolism in Escherichia coli.

Perrenoud A, Sauer U.

Institute of Biotechnology, ETH Zurich, CH-8093 Zurich, Switzerland.

Even though transcriptional regulation plays a key role in establishing the
metabolic network, the extent to which it actually controls the in vivo
distribution of metabolic fluxes through different pathways is essentially
unknown. Based on metabolism-wide quantification of intracellular fluxes, we
systematically elucidated the relevance of global transcriptional regulation by
ArcA, ArcB, Cra, Crp, Cya, Fnr, and Mlc for aerobic glucose catabolism in batch
cultures of Escherichia coli. Knockouts of ArcB, Cra, Fnr, and Mlc were
phenotypically silent, while deletion of the catabolite repression regulators
Crp and Cya resulted in a pronounced slow-growth phenotype but had only a
nonspecific effect on the actual flux distribution. Knockout of ArcA-dependent
redox regulation, however, increased the aerobic tricarboxylic acid (TCA) cycle
activity by over 60%. Like aerobic conditions, anaerobic derepression of TCA
cycle enzymes in an ArcA mutant significantly increased the in vivo TCA flux
when nitrate was present as an electron acceptor. The in vivo and in vitro data
demonstrate that ArcA-dependent transcriptional regulation directly or
indirectly controls TCA cycle flux in both aerobic and anaerobic glucose batch
cultures of E. coli. This control goes well beyond the previously known
ArcA-dependent regulation of the TCA cycle during microaerobiosis.

PMID: 15838044 [PubMed - indexed for MEDLINE]

3: J Bacteriol. 2005 Apr;187(8):2793-800. 

Catabolite repression of the propionate catabolic genes in Escherichia coli and
Salmonella enterica: evidence for involvement of the cyclic AMP receptor
protein.

Lee SK, Newman JD, Keasling JD.

Department of Chemical Engineering, University of California, Berkeley, CA
94720-1462, USA.

Previous studies with Salmonella enterica serovar Typhimurium LT2 demonstrated
that transcriptional activation of the prpBCDE operon requires the function of
transcription factor PrpR, sigma-54, and IHF. In this study, we found that
transcription from the prpBCDE and prpR promoters was down-regulated by the
addition of glucose or glycerol, indicating that these genes may be regulated by
the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex. Targeted mutagenesis
of a putative CRP-binding site in the promoter region between prpR and prpBCDE
suggested that these genes are under the control of CRP. Furthermore, cells with
defects in cya or crp exhibited reduced transcriptional activation of prpR and
prpBCDE in Escherichia coli. These results demonstrate that propionate
metabolism is subject to catabolite repression by the global transcriptional
regulator CRP and that this regulation is effected through control of both the
regulator gene prpR and the prpBCDE operon itself. The unique properties of the
regulation of these two divergent promoters may have important implications for
mechanisms of CRP-dependent catabolite repression acting in conjunction with a
member of the sigma-54 family of transcriptional activators.

PMID: 15805526 [PubMed - indexed for MEDLINE]

4: J Bacteriol. 2005 Mar;187(6):2066-76. 

Cyclic AMP (cAMP) and cAMP receptor protein influence both synthesis and uptake
of extracellular autoinducer 2 in Escherichia coli.

Wang L, Hashimoto Y, Tsao CY, Valdes JJ, Bentley WE.

Center for Biosystems Research, University of Maryland Biotechnology Institute,
College Park, MD 20742, USA.

Bacterial autoinducer 2 (AI-2) is proposed to be an interspecies mediator of
cell-cell communication that enables cells to operate at the multicellular
level. Many environmental stimuli have been shown to affect the extracellular
AI-2 levels, carbon sources being among the most important. In this report, we
show that both AI-2 synthesis and uptake in Escherichia coli are subject to
catabolite repression through the cyclic AMP (cAMP)-CRP complex, which directly
stimulates transcription of the lsr (for "luxS regulated") operon and indirectly
represses luxS expression. Specifically, cAMP-CRP is shown to bind to a CRP
binding site located in the upstream region of the lsr promoter and works with
the LsrR repressor to regulate AI-2 uptake. The functions of the lsr operon and
its regulators, LsrR and LsrK, previously reported in Salmonella enterica
serovar Typhimurium, are confirmed here for E. coli. The elucidation of cAMP-CRP
involvement in E. coli autoinduction impacts many areas, including the growth of
E. coli in fermentation processes.

PMID: 15743955 [PubMed - indexed for MEDLINE]

5: J Natl Med Assoc. 2005 Feb;97(2):276-80. 

Patients with spontaneous bacterial peritonitis, and malignant and cirrhotic
ascites.

Yildirim B, Sari R, Isci N.

Inonu University, School of Medicine, Department of Internal Medicine, Turgut
Ozal Medical Center, Malatya, Turkey.

BACKGROUND: Cytokines play a key role in the regulation of cells of the immune
system and also have been implicated in the pathogenesis of malignant diseases.
METHOD AND PATIENTS: We studied tumor necrosis factor-alpha, tumor necrosis
factor receptor and C-reactive protein levels in both ascitic fluid and serum in
patients with spontaneous bacterial peritonitis (SBP) (n = 22), and in the
malignant (n = 38) and cirrhotic (n = 32) ascites. RESULTS: C-reactive protein,
tumor necrosis factor-alpha and tumor necrosis factor receptor levels in the
ascitic fluid were found to be elevated in the SBP (p < 0.001) and malignant
groups (p < 0.005) when compared with the sterile cirrhotic group. C-reactive
protein levels in the serum were found to be elevated in the SBP group when
compared with the sterile cirrhotic (p < 0.001) and malignant group (p < 0.005).
Tumor necrosis factor-alpha in the serum was significantly elevated in the SBP
when compared with the cirrhotic (p < 0.005) and malignant ascites (p < 0.001).
Sensitivity and specificity of ascitic fluid CRP in discriminating malignant 84%
and 67% and SBP from sterile ascites were 90% and 76%, respectively. Sensitivity
and specificity of ascitic fluid TNF-alpha in discriminating malignant 77% and
60% and SBP from sterile ascites were 82% and 66%, respectively. Sensitivity and
specificity of TNF-r p60 in discriminating malignant 74% and 70% and SBP from
sterile ascites were 80% and 76%, respectively. CONCLUSION: The sensitivity and
specificity of ascitic fluid CRP, TNF-alpha and TNF-r values were found to be
similar. Ascitic fluid Creactive protein to differentiate SBP and malignant
ascitic from cirrhotic ascites are cheap, practical and safe tests used in the
differential diagnosis of ascites.

PMID: 15712792 [PubMed - indexed for MEDLINE]

6: J Bacteriol. 2005 Feb;187(3):980-90. 

Functional interactions between the carbon and iron utilization regulators, Crp
and Fur, in Escherichia coli.

Zhang Z, Gosset G, Barabote R, Gonzalez CS, Cuevas WA, Saier MH Jr.

Division of Biological Sciences, University of California at San Diego, La
Jolla, CA 92093-0116, USA.

In Escherichia coli, the ferric uptake regulator (Fur) controls expression of
the iron regulon in response to iron availability while the cyclic AMP receptor
protein (Crp) regulates expression of the carbon regulon in response to carbon
availability. We here identify genes subject to significant changes in
expression level in response to the loss of both Fur and Crp. Many iron
transport genes and several carbon metabolic genes are subject to dual control,
being repressed by the loss of Crp and activated by the loss of Fur. However,
the sodB gene, encoding superoxide dismutase, and the aceBAK operon, encoding
the glyoxalate shunt enzymes, show the opposite responses, being activated by
the loss of Crp and repressed by the loss of Fur. Several other genes including
the sdhA-D, sucA-D, and fumA genes, encoding key constituents of the Krebs
cycle, proved to be repressed by the loss of both transcription factors.
Finally, the loss of both Crp and Fur activated a heterogeneous group of genes
under sigmaS control encoding, for example, the cyclopropane fatty acid
synthase, Cfa, the glycogen synthesis protein, GlgS, the 30S ribosomal protein,
S22, and the mechanosensitive channel protein, YggB. Many genes appeared to be
regulated by the two transcription factors in an apparently additive fashion,
but apparent positive or negative cooperativity characterized several putative
Crp/Fur interactions. Relevant published data were evaluated, putative Crp and
Fur binding sites were identified, and representative results were confirmed by
real-time PCR. Molecular explanations for some, but not all, of these effects
are provided.

PMID: 15659676 [PubMed - indexed for MEDLINE]

7: Genes Dev. 2005 Feb 1;19(3):328-38. Epub 2005 Jan 13. 

Implication of membrane localization of target mRNA in the action of a small
RNA: mechanism of post-transcriptional regulation of glucose transporter in
Escherichia coli.

Kawamoto H, Morita T, Shimizu A, Inada T, Aiba H.

Division of Biological Science, Graduate School of Science, Nagoya University,
Chikusa, Nagoya 464-8602, Japan.

Accumulation of phosphosugars such as glucose-6-phosphate causes a rapid
degradation of ptsG mRNA encoding the major glucose transporter IICB(Glc) in an
RNase E/degradosome-dependent manner. The destabilization of ptsG mRNA is caused
by a small antisense RNA (SgrS) that is induced by phosphosugar stress. In this
study, we analyzed a series of ptsG-crp translational fusions to identify the
mRNA region required for the rapid degradation of ptsG mRNA. We found that the
ptsG-crp mRNA is destabilized in response to phosphosugar stress when it
contains the 5' portion of ptsG mRNA corresponding up to the first two
transmembrane domains (TM1 and TM2) of IICB(Glc). The destabilization of
ptsG-crp mRNA was largely eliminated by frameshift mutations in the
transmembrane region. The IICB(Glc)-CRP fusion proteins containing more than two
transmembrane domains were localized at the membrane. The efficient
destabilization of ptsG-crp mRNA was restored when TM1 and TM2 of IICB(Glc) were
replaced by part of the LacY transmembrane region. We conclude that the
membrane-targeting property of IICB(Glc) protein rather than the particular
nucleotide or amino acid sequence is required for the efficient degradation of
ptsG mRNA in response to metabolic stress. The stimulation of ptsG-crp mRNA
degradation was completely eliminated when either the hfq or sgrS gene is
inactivated. The efficient mRNA destabilization was observed in the absence of
membrane localization when translation was reduced by introducing a mutation in
the ribosome-binding site in the cytoplasmic ptsG-crp mRNA. Taken together, we
conclude that mRNA localization to the inner membrane coupled with the membrane
insertion of nascent peptide mediates the Hfq/SgrS-dependent ptsG mRNA
destabilization presumably by reducing second rounds of translation.

PMID: 15650111 [PubMed - indexed for MEDLINE]

8: Genetika. 2004 Nov;40(11):1457-68. 

[Involvement of sigma S and sigma 70 subunits of RNA polymerase and the CRP
protein in the regulation of microcin C51 operon expression]

[Article in Russian]

Veselovskii AM, Bass IA, Zolotukhina MA, Mironov AS, Metlitskaia AZ, Khmel' IA.

Expression of the microcin C51 operon in Escherichia coli cells is activated
during cell entry into the stationary growth phase and depends on the sigmaS
subunit of RNA polymerase (RpoS). The null rpoS mutations retained the residual
expression level of the transcriptional P(mcc)-lac fusion, which indicates that
other sigma subunit can participate in the regulation of transcription of the
microcin C51 operon. Data presented in this work show that the overproduction of
sigma70 in rpoS- cells diminished the level of P(mcc)-lac expression, as in
wild-type cells, which seems to be the consequence of competition between sigma
factors for a limited number of core RNA polymerase molecules. In the presence
of the rpoD800 mutation that renders sigma70 temperature-sensitive, expression
of P(mcc)-lac was not induced in the phase of delayed culture growth at
nonpermissive temperature, which indicates that sigma70 is indispensable for
microcin operon expression. Point substitutions in the -10 P(mcc) region,
leading to the formation of 5'-TGaTATAAT-3' site, enhanced promoter activity but
did not affect the relationship between P(mcc)-lac transcription and growth
phase, sigmaS, and the activator protein CRP. The activator protein CRP was
shown to bind a DNA fragment containing the TGTGA(AATGAA)TCTAT site in the -59.5
bp position relative to the start site of transcription. Mutation in the ssrI
gene encoding 6S RNA did not disturb P9mcc)-lac expression; these results
indicate that 6S RNA does not participate in the regulation of microcin C51
operon expression.

PMID: 15612564 [PubMed - indexed for MEDLINE]

9: Nucleic Acids Res. 2004 Nov 1;32(19):5874-93. Print 2004. 

Identification of the CRP regulon using in vitro and in vivo transcriptional
profiling.

Zheng D, Constantinidou C, Hobman JL, Minchin SD.

School of Biosciences, University of Birmingham, Birmingham B15 2TT, UK.

The Escherichia coli cyclic AMP receptor protein (CRP) is a global regulator
that controls transcription initiation from more than 100 promoters by binding
to a specific DNA sequence within cognate promoters. Many genes in the CRP
regulon have been predicted simply based on the presence of DNA-binding sites
within gene promoters. In this study, we have exploited a newly developed
technique, run-off transcription/microarray analysis (ROMA) to define
CRP-regulated promoters. Using ROMA, we identified 176 operons that were
activated by CRP in vitro and 16 operons that were repressed. Using positive
control mutants in different regions of CRP, we were able to classify the
different promoters into class I or class II/III. A total of 104 operons were
predicted to contain Class II CRP-binding sites. Sequence analysis of the
operons that were repressed by CRP revealed different mechanisms for CRP
inhibition. In contrast, the in vivo transcriptional profiles failed to identify
most CRP-dependent regulation because of the complexity of the regulatory
network. Analysis of these operons supports the hypothesis that CRP is not only
a regulator of genes required for catabolism of sugars other than glucose, but
also regulates the expression of a large number of other genes in E.coli. ROMA
has revealed 152 hitherto unknown CRP regulons.

PMID: 15520470 [PubMed - indexed for MEDLINE]

10: J Mol Biol. 2004 Nov 5;343(5):1171-82. 

An RNA polymerase mutant deficient in DNA melting facilitates study of
activation mechanism: application to an artificial activator of transcription.

Sun L, Dove SL, Panaghie G, deHaseth PL, Hochschild A.

Department of Microbiology and Molecular Genetics, Harvard Medical School, 200
Longwood Avenue, Boston, MA 02115, USA.

Transcription initiation is a major target for the regulation of gene expression
in all organisms. Transcription activators can stimulate different steps in the
initiation process including the initial binding of RNA polymerase (RNAP) to the
promoter and a subsequent promoter-melting step. Typically, kinetic assays are
required to determine whether an activator exerts its effect on the initial
binding of RNAP or on the promoter-melting step. Here we take advantage of a
mutant Escherichia coli RNAP that is deficient in promoter melting to assess the
ability of an activator to stabilize the initial binding of RNAP to the
promoter. For the well-characterized activator CRP, we show that this RNAP
mutant can be used to distinguish between effects on initial binding and
promoter melting; these results provide an independent confirmation of the
results of kinetic analysis. We then employ the melting-deficient RNAP mutant to
demonstrate an effect of an artificial activator of transcription on the initial
binding of RNAP. Our findings demonstrate that a melting-deficient RNAP mutant
can be used to trap a normally unstable intermediate in transcription
initiation, thus providing a novel tool for probing activation mechanism.

PMID: 15491604 [PubMed - indexed for MEDLINE]

11: J Mol Biol. 2004 Sep 3;342(1):1-7. 

A role for the interdomain linker region of the Escherichia coli CytR regulator
in repression complex formation.

Kallipolitis BH, Valentin-Hansen P.

Department of Biochemistry and Molecular Biology, University of Southern
Denmark, Campusvej 55, DK-5230 Odense M. bnk@bmb.sdu.dk

Regulatory complexes formed by the CytR repressor protein and the cAMP receptor
protein (CRP) prevent transcription initiation from several promoters in
Escherichia coli. The formation of the complexes is mediated by protein-DNA
interactions and protein-protein interactions between the two regulators.
Interestingly, co-binding with CRP has a profound effect on the configuration of
the DNA-binding targets preferred by CytR. When binding to DNA by itself, CytR
binds preferentially to two octamer repeats in direct or inverted orientation,
and separated by 2 bp. However, in the presence of CRP, CytR recognizes inverted
repeats separated by 10-13 bp, or direct repeats separated by 1 bp. A fixed
orientation of at least one CytR octamer repeat in close proximity to a
CRP-binding target is a common architectural feature at promoters optimised for
repression complex formation. These observations suggest that CRP alters the
DNA-binding mode of CytR. Here, we have investigated the CRP-induced changes in
CytR by protein footprinting and alanine-scanning mutagenesis. Our data suggest
that a flexible interdomain linker region in CytR, connecting the DNA-binding
domain to the dimerization domain allows the repressor protein to interact with
DNA-binding sites in a highly relaxed manner, as shown previously, and plays an
active role in transcription regulation. Thus, the interactions between CRP,
CytR and DNA within the repression complex appear to be more extensive than
anticipated. The results support and extend the view that the high degree of
adaptability observed in the CytR/CRP regulatory system is obtained though
multiple adjustable interactions between the implicated factors.

PMID: 15313602 [PubMed - indexed for MEDLINE]

12: J Biol Chem. 2004 Sep 10;279(37):38513-8. Epub 2004 Jul 13. 

Expression of ptsG encoding the major glucose transporter is regulated by ArcA
in Escherichia coli.

Jeong JY, Kim YJ, Cho N, Shin D, Nam TW, Ryu S, Seok YJ.

Laboratory of Macromolecular Interactions, School of Biological Sciences and
Institute of Microbiology, Seoul National University, Seoul 151-742, Korea.

Because the phosphoenolpyruvate:sugar phosphotransferase system plays multiple
regulatory roles in addition to the phosphorylation-coupled transport of many
sugars in bacteria, synthesis of its protein components is regulated in a highly
sophisticated way. Thus far, the cAMP receptor protein (CRP) complex and Mlc are
known to be the major regulators of ptsHIcrr and ptsG expression in response to
the availability of carbon sources. In this report, we performed ligand fishing
experiments by using the promoters of ptsHIcrr and ptsG as bait to find out new
factors involved in the transcriptional regulation of the
phosphoenolpyruvate:sugar phosphotransferase system in Escherichia coli, and we
found that the anaerobic regulator ArcA specifically binds to the promoters.
Deletion of the arcA gene caused about a 2-fold increase in the ptsG expression,
and overexpression of ArcA significantly decreased glucose consumption. In vitro
transcription assays showed that phospho-ArcA (ArcA-P) represses ptsG P1
transcription. DNase I footprinting experiments revealed that ArcA-P binds to
three sites upstream of the ptsG P1 promoter, two of which overlap the
CRP-binding sites, and the ArcA-P binding decreases the CRP binding that is
essential for the ptsG P1 transcription. These results suggest that the response
regulator ArcA regulates expression of enzyme IICB(Glc) mediating the first step
of glucose metabolism in response to the redox conditions of growth in E. coli.

PMID: 15252051 [PubMed - indexed for MEDLINE]

13: Mol Microbiol. 2004 Jun;52(6):1553-65. 

New Listeria monocytogenes prfA* mutants, transcriptional properties of PrfA*
proteins and structure-function of the virulence regulator PrfA.

Vega Y, Rauch M, Banfield MJ, Ermolaeva S, Scortti M, Goebel W, Vazquez-Boland
JA.

Grupo de Patogenesis Molecular Bacteriana, Unidad de Microbiologia e
Inmunologia, Facultad de Veterinaria, Universidad Complutense de Madrid and
Universidad de Leon, Spain.

PrfA, a transcription factor structurally related to Crp/Fnr, activates Listeria
monocytogenes virulence genes during intracellular infection. We report two new
PrfA* mutations causing the constitutive overexpression of the PrfA regulon.
Leu-140Phe lies in alphaD adjacent to the DNA-binding motif in the C-terminal
domain, like a previously characterized PrfA* mutation (Gly-145Ser). Ile-45Ser,
in contrast, maps to the N-terminal beta-roll, a structure similar to that of
the Crp cAMP binding site. The in vitro transcriptional properties of
recombinant PrfA*(I45S) and PrfA*(G145S) were compared to those of PrfA(WT) at
two differentially regulated PrfA-dependent promoters, PplcA and PactA. The two
PrfA* mutations increased the affinity for the target DNA to a different extent,
and the differences in DNA binding (PrfA*(G145S) > PrfA*(I45S) >>> PrfA(WT))
correlated with proportional differences in transcriptional activity. The use of
the PrfA* proteins revealed that PplcA had a greater affinity for, and was more
sensitive to, PrfA than PactA. RNA polymerase (RNAP) initiated transcription
independently of PrfA at PplcA, but not at PactA, consistent with bandshift
experiments suggesting that PplcA has a greater affinity for RNAP than PactA.
Thus, differences in affinity for both PrfA and RNAP appear to determine the
different expression pattern of PrfA-regulated promoters. Modelling of the PrfA*
mutations in the crystal structure of PrfA and comparison with
structure-function analyses of Crp, in which similar mutations lead to
constitutively active (cAMP-independent) Crp* proteins, suggested that PrfA
shares with Crp an analogous mechanism of cofactor-mediated allosteric shift.
Our data support a regulatory model in which changes in PrfA-dependent gene
expression are primarily accounted for by changes in PrfA activity.

PMID: 15186408 [PubMed - indexed for MEDLINE]

14: J Biol Chem. 2004 Aug 6;279(32):33253-62. Epub 2004 May 24. 

Regulation of penicillin G acylase gene expression in Escherichia coli by
repressor PaaX and the cAMP-cAMP receptor protein complex.

Kim HS, Kang TS, Hyun JS, Kang HS.

Department of Microbiology, School of Biological Sciences, Seoul National
University, San 56-1, Shillim-dong, Kwanak-gu, 151-742, Korea.

The pga gene of Escherichia coli W ATCC11105 encodes a penicillin G acylase
whose expression is regulated at both the transcriptional and
post-transcriptional level. In this work we have shown that PaaX is the
repressor of pga expression, and we have identified its binding consensus as
TGATTC(N27)GAATCA. We conclude that the process of "PAA induction" actually
involves relief of pga from repression by PaaX. Other features of the pga
promoter have also been characterized. (i) It has a native class III
cAMP-receptor protein (CRP)-dependent promoter with two CRP-binding sites. (ii)
The downstream CRP-binding site II has higher affinity. (iii) Binding of
cAMP-CRP to both sites (I + II) is required for maximal expression. We have also
shown that the PaaX-binding site overlaps with the CRP-binding site I. This
implies that PaaX and the cAMP-CRP compete for binding to the region around the
CRP-binding site I and therefore have antagonistic effects on pga expression.

PMID: 15159386 [PubMed - indexed for MEDLINE]

15: J Bacteriol. 2004 Jun;186(11):3516-24. 

Transcriptome analysis of Crp-dependent catabolite control of gene expression in
Escherichia coli.

Gosset G, Zhang Z, Nayyar S, Cuevas WA, Saier MH Jr.

Division of Biological Sciences, University of California at San Diego, La
Jolla, California 92093-0116, USA.

We report here the transcriptome analyses of highly expressed genes that are
subject to catabolite repression or activation mediated by the cyclic AMP
receptor protein (Crp). The results reveal that many operons encoding enzymes of
central carbon metabolic pathways (e.g., Krebs cycle enzymes), as well as
transporters and enzymes that initiate carbon metabolism, are subject to direct
Crp-mediated catabolite repression. By contrast, few enzyme-encoding genes
(direct regulation) but many ribosomal protein- and tRNA-encoding genes
(indirect regulation) are subject to Crp-dependent glucose activation.
Additionally, Crp mediates strong indirect catabolite repression of many
cytoplasmic stress response proteins, including the major chaperone proteins,
five ATP-dependent protease complexes, and several cold and heat shock proteins.
These results were confirmed by (i) phenotypic analyses, (ii) real-time PCR
studies, (iii) reporter gene fusion assays, and (iv) previously published
reports about representative genes. The results serve to define and extend our
appreciation of the Crp regulon.

PMID: 15150239 [PubMed - indexed for MEDLINE]

16: Mol Biotechnol. 2004 May;27(1):7-14. 

Separate control of Rep and Cap expression using mutant and wild-type loxP
sequences and improved packaging system for adeno-associated virus vector
production.

Mizukami H, Okada T, Ogasawara Y, Matsushita T, Urabe M, Kume A, Ozawa K.

Division of Genetic Therapeutics, Center for Molecular Medicine, Jichi Medical
School, 3311-1, Yakushiji, Minamikawachi-machi, Kawachi-gun, Tochigi, 329-0498,
Japan.

Adeno-associated virus (AAV) vectors are a practical choice for gene transfer,
and demand for them is increasing. To cope with the necessity in the near
future, we have developed a number of approaches to establish packaging cell
lines for the production of AAV vectors. In our previous study, a highly
regulated expression of large Rep proteins was obtained by using the Cre-loxP
switching system. Therefore, in the present study, to regulate Cap expression as
well, we developed an inducible expression system for both Rep and Cap proteins
by using an additional set of mutant loxP sequences. The mutants possess two
base alterations in the spacer region of loxP and recombine specifically with
the same counterpart in the presence of Cre. By using two separate plasmids, one
with mutant and the other with wild-type loxP sequences, the expression of two
different proteins can be induced simultaneously by Cre recombinase. When the
LacZ-encoding plasmid vector was used as a packaging model, a significant
packaging titer of 2.1 x 1010 genome copies per 10-cm dish was obtained. These
results indicate the importance of controlling Cap expression, in addition to
Rep, to achieve an optimum production rate for AAV vectors.

PMID: 15122043 [PubMed - indexed for MEDLINE]

17: Biochemistry. 2004 Apr 27;43(16):4662-9. 

Role of residue 138 in the interdomain hinge region in transmitting allosteric
signals for DNA binding in Escherichia coli cAMP receptor protein.

Yu S, Lee JC.

Department of Human Biological Chemistry and Genetics, The University of Texas
Medical Branch at Galveston, Galveston, Texas 77555-1055, USA.

The cAMP receptor protein (CRP) of Escherichia coli is a transcription factor.
The affinity of CRP for a specific DNA sequence is significantly enhanced as a
consequence of the binding of the allosteric effector, cAMP. The hinge region,
particularly residues 136 and 138, connecting the cAMP and DNA binding domains
of CRP has been proposed to play essential roles in transmitting the allosteric
signals. To probe the specific role of residue 138, eight D138 mutants and
wild-type CRP were tested for their ability to bind the lac26 and gallac26
promoter sequences in this study. A correlation was established between DNA
binding affinity and side chain solvation free energy, namely, an increasing
specific DNA affinity with an increasing hydrophilicity of the side chain of
residue 138. In addition, a linear correlation was found between DNA binding
affinity and the energetics of subunit assembly. The ability of CRP to
distinguish between cAMP and cGMP as an allosteric activator of DNA binding is
weakened with higher energetics of subunit assembly. This correlation indicates
that quaternary constraint leads to a constraint of the DNA binding domain. This
observation is consistent with the concept that an optimum quaternary structural
constraint is important in CRP exhibiting its allosteric properties. The
stability of CRP was monitored by Trp fluorescence and circular dichroism in the
presence of guanidine hydrochloride. These spectroscopic data revealed
nonidentical denaturation profiles. Since the Trp residues are located
exclusively in the beta-roll cyclic nucleotide binding domain, the denaturation
profiles reveal the stability of the beta-roll structure. This study produces
another linear correlation between DNA binding affinity in the presence of cAMP
and cGMP and the stability of the beta-roll; namely, the stability of the
beta-roll structure leads to a decrease in DNA binding affinity. All these
correlations indicate the importance of structural stability and dynamics in the
ability of CRP to manifest its intrinsic allosteric properties.

PMID: 15096034 [PubMed - indexed for MEDLINE]

18: Mol Microbiol. 2004 Apr;52(2):589-600. 

The histone-like nucleoid structuring protein H-NS represses the Escherichia
coli bgl operon downstream of the promoter.

Dole S, Nagarajavel V, Schnetz K.

Institute for Genetics, University Cologne,Weyertal 121, 50931 Cologne, Germany.

Specificity of repression by the histone-like nucleoid structuring protein and
pleiotropic regulator, H-NS, is exceptionally high in case of the Escherichia
coli bgl (beta-glucoside) operon. Here we present evidence that H-NS represses
the operon at two levels. The binding of H-NS to an upstream silencer results in
an approximately threefold repression of the catabolite gene regulator protein
(CRP) dependent bgl promoter. In addition, H-NS binds to a silencer region
located approximately 600-700 base pairs downstream of the promoter, within the
coding region of first gene, bglG, resulting in a approximately sevenfold
further decrease of expression. Repression by H-NS at the downstream silencer
requires termination factor Rho and is reduced by translation of the bglG mRNA,
but is independent of the promoter. This suggests that H-NS induces polarity of
transcription by acting as a roadblock to the elongating RNA polymerase. The
control of the bgl operon by H-NS at two levels results in a highly specific
repression.

PMID: 15066043 [PubMed - indexed for MEDLINE]

19: Mol Microbiol. 2004 Apr;52(2):437-49. 

Expression of the chitobiose operon of Escherichia coli is regulated by three
transcription factors: NagC, ChbR and CAP.

Plumbridge J, Pellegrini O.

Institut de Biologie Physico-Chimique (CNRS UPR9073), 13, rue Pierre et Marie
Curie, 75005 Paris, France. Jackie.Plumbridge@ibpc.fr

The chitobiose operon, chbBCARFG, encodes genes for the transport and
degradation of the N-acetylglucosamine disaccharide, chitobiose. Chitobiose is
transported by the phosphotransferase system (PTS) producing chitobiose-6P which
is hydrolysed to GlcNAc-6P by the chbF gene product and then further degraded by
the nagBA gene products. Expression of the chb operon is repressed by NagC,
which regulates genes involved in amino sugar metabolism. The inducer for NagC
is GlcNAc-6P. NagC binds to two sites separated by 115 bp and the transcription
start point of the chb operon lies within the downstream NagC operator. In
addition the chb operon encodes its own specific regulator, ChbR, an AraC-type
dual repressor-activator, which binds to two direct repeats of 19 bp located
between the two NagC sites. ChbR is necessary for transcription activation in
the presence of chitobiose in vivo. Induction of the operon also requires CAP,
which binds to a site upstream of the ChbR repeats. In the absence of chitobiose
both NagC and ChbR act as repressors. Together these three factors cooperate in
switching chb expression from the repressed to the activated state. The need for
two specific inducing signals, one for ChbR to activate the expression of the
operon and a second for NagC to relieve its repression, ensure that the chb
operon is only induced when there is sufficient flux through the combined
chb-nag metabolic pathway to activate expression of both the chb and nag
operons.

PMID: 15066032 [PubMed - indexed for MEDLINE]

20: FEBS Lett. 2004 Apr 9;563(1-3):55-8. 

Systematic single base-pair substitution analysis of DNA binding by the cAMP
receptor protein in cyanobacterium Synechocystis sp. PCC 6803.

Omagari K, Yoshimura H, Takano M, Hao D, Ohmori M, Sarai A, Suyama A.

Department of Life Sciences, Graduate School of Arts and Sciences, The
University of Tokyo, Komaba, Meguro, Tokyo 153-8902, Japan.

The cAMP receptor protein SYCRP1 in cyanobacterium Synechocystis sp. PCC 6803 is
a regulatory protein that binds to the consensus DNA sequence
(5'-AAATGTGATCTAGATCACATTT-3') for the cAMP receptor protein CRP in Escherichia
coli. Here we examined the effects of systematic single base-pair substitutions
at positions 4-8 (TGTGA) of the consensus sequence on the specific binding of
SYCRP1. The consensus sequence exhibited the highest affinity, and the effects
of base-pair substitutions at positions 5 and 7 were the most deleterious. The
result is similar to that previously reported for CRP, whereas there were
differences between SYCRP1 and CRP in the rank order of affinity for each
substitution.

PMID: 15063722 [PubMed - indexed for MEDLINE]

21: Biochemistry. 2004 Apr 6;43(13):3844-52. 

A linear correlation between the energetics of allosteric communication and
protein flexibility in the Escherichia coli cyclic AMP receptor protein revealed
by mutation-induced changes in compressibility and amide hydrogen-deuterium
exchange.

Gekko K, Obu N, Li J, Lee JC.

Department of Mathematical and Life Sciences, Graduate School of Science,
Hiroshima University, Higashi-Hiroshima 739-8526, Japan.

Amino acid substitutions at distant sites in the Escherichia coli cyclic AMP
receptor protein (CRP) have been shown to affect both the nature and magnitude
of the energetics of cooperativity of cAMP binding, ranging from negative to
positive. In addition, the binding to DNA is concomitantly affected. To
correlate the effects of amino acid substitutions on the functional energetics
and global structural properties in CRP, the partial specific volume (v(o)), the
coefficient of adiabatic compressibility (beta(s)(o)), and the rate of amide
proton exchange were determined for the wild-type and eight mutant CRPs (K52N,
D53H, S62F, T127L, G141Q, L148R, H159L, and K52N/H159L) by using sound velocity,
density measurements, and hydrogen-deuterium exchange as monitored by Fourier
transform infrared spectroscopy at 25 degrees C. These mutations induced large
changes in v(o) (0.747-0.756 mL/g) and beta(s)(o) (6.89-9.68 Mbar(-1)) compared
to the corresponding values for wild-type CRP (v(o)= 0.750 mL/g and beta(s)(o)=
7.98 Mbar(-1)). These changes in global structural properties correlated with
the rate of amide proton exchange. A linear correlation was established between
beta(s)(o) and the energetics of cooperativity of binding of cAMP to the
high-affinity sites, regardless of the nature of cooperativity, be it negative
or positive. This linear correlation indicates that the nature and magnitude of
cooperativity are a continuum. A similar linear correlation was established
between compressibility and DNA binding affinity. In addition, linear
correlations were also found among the dynamics of CRP and functional
energetics. Double mutation (K52N/H159L) at positions 52 and 159, whose
alpha-carbons are separated by 34.6 A, showed nonadditive effects on v(o) and
beta(s)(o). These results demonstrate that a small alteration in the local
structure due to amino acid substitution is dramatically magnified in the
overall protein dynamics which plays an important role in modulating the
allosteric behavior of CRP.

PMID: 15049691 [PubMed - indexed for MEDLINE]

22: J Bacteriol. 2004 Apr;186(7):2215-20. 

The PaaX repressor, a link between penicillin G acylase and the
phenylacetyl-coenzyme A catabolon of Escherichia coli W.

Galan B, Garcia JL, Prieto MA.

Department of Molecular Microbiology, Centro de Investigaciones Biologicas,
CSIC, Madrid, Spain.

The pac gene, encoding the penicillin G acylase from Escherichia coli W, is
regulated by the PaaX repressor of the phenylacetate catabolic pathway. pac
expression depends on the synthesis of phenylacetyl-coenzyme A. PaaX and the
cyclic AMP receptor protein (CRP) bind in vitro to the Ppac promoter region. A
palindromic sequence proposed as the PaaX operator is located upstream of the
-35 box overlapping a CRP binding site, an unusual position that suggests a
novel regulatory mechanism.

PMID: 15028709 [PubMed - indexed for MEDLINE]

23: Genetika. 2004 Jan;40(1):15-25. 

[Structural-functional analysis of the promoter region of Escherichia coli udp
gene]

[Article in Russian]

Ovcharova IV, Eremina SIu, Mironov AS.

State Research Institute of Genetics and Selection of Industrial Microorganisms,
Moscow, 113545 Russia.

Effect of mutations in the -10 and -35 regions of the udp gene promoter on the
nature of its regulation by CytR and CRP proteins was studied. In studies of
expression of mutant promoters, competition between RNA polymerase and the CytR
repressor for the promoter region of the udp gene was shown. In the presence of
the improved -10 region, the introduction of a substitution 15C-->T (that is the
presence of the elongated Pribnow block) resulted in the CRP-independent
transcription of the udp gene promoter. The binding site CRP2 was shown to be
indispensable for the maximum promoter activation by the
transcription-activating cAMP-CRP complex. Both positive (cAMP-CRP complex) and
negative (CytR) regulation of the promoter was virtually fully abolished after
the introduction of mutations leading to the creation of canonical sequences in
-10 and -35 promoter regions.

PMID: 15027196 [PubMed - indexed for MEDLINE]

24: J Bacteriol. 2004 Mar;186(6):1720-8. 

Regulation of expression of the divergent ulaG and ulaABCDEF operons involved in
LaAscorbate dissimilation in Escherichia coli.

Campos E, Baldoma L, Aguilar J, Badia J.

Department of Biochemistry, Faculty of Pharmacy, University of Barcelona, 08028
Barcelona, Spain.

The ula regulon, responsible for the utilization of L-ascorbate in Escherichia
coli, is formed by two divergently transcribed operons, ulaG and ulaABCDEF. The
regulon is negatively regulated by a repressor of the DeoR family which is
encoded by the constitutive gene ulaR located downstream of ulaG. Full
repression of the ula regulon requires simultaneous interaction of the repressor
with both divergent promoters and seems to be dependent on repressor-mediated
DNA loop formation, which is helped by the action of integration host factor.
Two operator sites have been identified in each promoter. Lack of either of the
two sets of operators partially relieved the repression of the other operon;
thus, each promoter is dependent on the UlaR operator sites of the other
promoter to enhance repression. Electrophoretic mobility shift assays with
purified UlaR protein and promoter deletion analyses revealed a conserved
sequence, present in each of the four operators, acting as a UlaR binding site.
Glucose represses the ula regulon via at least two mechanisms, one dependent on
cyclic AMP (cAMP)-cAMP receptor protein (CRP) and the other (possibly inducer
exclusion) independent of it. Glucose effects mediated by other global
regulators cannot be ruled out with the present information. Changes in cAMP-CRP
levels affected only the expression of the ulaABCDEF operon.

PMID: 14996803 [PubMed - indexed for MEDLINE]

25: J Bacteriol. 2004 Mar;186(6):1620-8. 

Regulation of Escherichia coli hemolysin E expression by H-NS and Salmonella
SlyA.

Wyborn NR, Stapleton MR, Norte VA, Roberts RE, Grafton J, Green J.

The Krebs Institute for Biomolecular Research, Department of Molecular Biology
and Biotechnology, University of Sheffield, Western Bank, Sheffield S10 2TN,
United Kingdom.

The Escherichia coli hlyE gene (also known as clyA or sheA) codes for a novel
pore-forming toxin. Previous work has shown that the global transcription
factors FNR and CRP positively regulate hlyE expression by binding at the same
site. Here in vivo transcription studies reveal that FNR occupies the hlyE
promoter more frequently than CRP, providing a mechanism for the moderate
upregulation of hlyE expression in response to two distinct environmental
signals (oxygen and glucose starvation). It has been reported that H-NS
interacts with two large regions of the hlyE promoter (PhlyE), one upstream of
the -35 element and one downstream of the -10 element. Here we identify two
high-affinity H-NS sites, H-NS I, located at the 3' end of the extended upstream
footprint, and H-NS II, located at the 5' end of the extended downstream
footprint. It is suggested that these high-affinity sites initiate the
progressive formation of higher order complexes, allowing a range of
H-NS-mediated regulatory effects at PhlyE. Finally, the identification of a SlyA
binding site that overlaps the H-NS I site in PhlyE suggests a mechanism to
explain how SlyA overproduction enhances hlyE expression by antagonizing the
negative effects of H-NS.

PMID: 14996792 [PubMed - indexed for MEDLINE]

26: Res Microbiol. 2004 Mar;155(2):76-9. 

Relief of catabolite repression in a cAMP-independent catabolite gene activator
mutant of Escherichia coli.

Karimova G, Ladant D, Ullmann A.

Department of Structural Biology and Chemistry, CNRS URA 2185, Institut Pasteur,
28, rue du Docteur Roux, 75724 Paris Cedex 15, France.

We isolated and characterized a new catabolite gene activator mutant (crp*) of
Escherichia coli that confers cAMP-independent expression and total relief of
catabolite repression of beta-galactosidase and tryptophanase synthesis. The two
mutations responsible for this phenotype change the amino acids at codon 72 from
Glu to Ala and at codon 144 from Ala to Thr in the corresponding CAP* protein.

PMID: 14990258 [PubMed - indexed for MEDLINE]

27: J Bacteriol. 2004 Mar;186(5):1388-97. 

Transcriptional organization and regulation of the L-idonic acid pathway (GntII
system) in Escherichia coli.

Bausch C, Ramsey M, Conway T.

Department of Botany and Microbiology, University of Oklahoma, Norman, Oklahoma
73019.

The genetic organization of the idn genes that encode the pathway for L-idonate
catabolism was characterized. The monocistronic idnK gene is transcribed
divergently from the idnDOTR genes, which were shown to form an operon. The
215-bp regulatory region between the idnK and idnD genes contains promoters in
opposite orientation with transcription start sites that mapped to positions -26
and -29 with respect to the start codons. The regulatory region also contains a
single putative IdnR/GntR binding site centered between the two promoters, a CRP
binding site upstream of idnD, and an UP element upstream of idnK. The genes of
the L-idonate pathway were shown to be under catabolite repression control.
Analysis of idnD- and idnK-lacZ fusions in a nonpolar idnD mutant that is unable
to interconvert L-idonate and 5-ketogluconate indicated that either compound
could induce the pathway. The L-idonate pathway was first characterized as a
subsidiary pathway for D-gluconate catabolism (GntII), which is induced by
D-gluconate in a GntI (primary gluconate system) mutant. Here we showed that the
idnK and idnD operons are induced by D-gluconate in a GntI system mutant,
presumably by endogenous formation of 5-ketogluconate from D-gluconate. Thus,
the regulation of the GntII system is appropriate for this pathway, which is
primarily involved in L-idonate catabolism; the GntII system can be induced by
D-gluconate under conditions that block the GntI system.

PMID: 14973046 [PubMed - indexed for MEDLINE]

28: Mol Microbiol. 2004 Feb;51(3):813-26. 

Application of AgaR repressor and dominant repressor variants for verification
of a gene cluster involved in N-acetylgalactosamine metabolism in Escherichia
coli K-12.

Ray WK, Larson TJ.

Department of Biochemistry, Virginia Polytechnic Institute and State University,
Blacksburg, Virginia 24061, USA.

The agaZVWEFASYBCDI gene cluster encodes the phosphotransferase systems and
enzymes responsible for the uptake and metabolism of N-acetylgalactosamine and
galactosamine in Escherichia coli. In some strains of E. coli, particularly the
common K-12 strain, a portion of this cluster is missing because of a
site-specific recombination event that occurred between sites in agaW and agaA.
Strains that have undergone this recombination event have lost the ability to
utilize either N-acetylgalactosamine or galactosamine as sole sources of carbon.
Divergently transcribed from this gene cluster is the gene agaR encoding a
transcriptional repressor belonging to the DeoR/GlpR family of transcriptional
regulators. Promoters upstream of agaR, agaZ and agaS were characterized. All
three promoters had elevated activity in the presence of N-acetylgalactosamine
or galactosamine, were regulated in vivo by AgaR and possessed specific
DNA-binding sites for AgaR upstream from the start sites of transcription as
determined by DNase I footprinting. In vivo analysis and DNase I footprinting
indicated that the promoter specific for agaZ also requires activation by
cAMP-CRP. Previous work with GlpR and other members of the DeoR/GlpR family have
identified highly conserved amino acid residues that function in DNA-binding or
response to inducer. These residues of AgaR were targeted for site-directed
mutagenesis and yielded variants of AgaR that were either negatively dominant or
non-inducible. The apparent ability to produce negatively dominant and
non-inducible variants of proteins of the DeoR/GlpR family of currently unknown
function will likely facilitate screening for function.

PMID: 14731281 [PubMed - indexed for MEDLINE]

29: Mol Microbiol. 2004 Feb;51(3):799-811. 

Multiple stress signal integration in the regulation of the complex sigma
S-dependent csiD-ygaF-gabDTP operon in Escherichia coli.

Metzner M, Germer J, Hengge R.

Institut fur Biologie, Mikrobiologie, Freie Universitat Berlin, 14195 Berlin,
Germany.

The csiD-ygaF-gabDTP region in the Escherichia coli genome represents a cluster
of sigma S-controlled genes. Here, we investigated promoter structures, sigma
factor dependencies, potential co-regulation and environmental regulatory
patterns for all of these genes. We find that this region constitutes a complex
operon with expression being controlled by three differentially regulated
promoters: (i) csiDp, which affects the expression of all five genes, is
cAMP-CRP/sigma S-dependent and activated exclusively upon carbon starvation and
stationary phase; (ii) gabDp1, which is sigma S-dependent and exhibits multiple
stress induction like sigma S itself; and (iii) gabDp2[previously suggested by
Schneider, B.L., Ruback, S., Kiupakis, A.K., Kasbarian, H., Pybus, C., and
Reitzer, L. (2002) J. Bacteriol. 184: 6976-6986], which appears to be Nac/sigma
70-controlled and to respond to poor nitrogen sources. In addition, we identify
a novel repressor, CsiR, which modulates csiDp activity in a temporal manner
during early stationary phase. Finally, we propose a physiological role for
sigma S-controlled GabT/D-mediated gamma-aminobutyrate (GABA) catabolism and
glutamate accumulation in general stress adaptation. This physiological role is
reflected by the activation of the operon-internal gabDp1 promoter under the
different conditions that also induce sigma S, which include shifts to acidic pH
or high osmolarity as well as starvation or stationary phase.

PMID: 14731280 [PubMed - indexed for MEDLINE]

30: Mol Microbiol. 2004 Jan;51(1):241-54. 

Modulation of CRP-dependent transcription at the Escherichia coli acsP2 promoter
by nucleoprotein complexes: anti-activation by the nucleoid proteins FIS and
IHF.

Browning DF, Beatty CM, Sanstad EA, Gunn KE, Busby SJ, Wolfe AJ.

Department of Microbiology and Immunology, Stritch School of Medicine, Loyola
University Chicago, Maywood, IL 60153, USA.

acs encodes acetyl-coenzyme A synthetase, a high-affinity enzyme that allows
cells to scavenge for acetate during carbon starvation. CRP activates acs
transcription by binding tandem DNA sites located upstream of the major
promoter, acsP2. Here, we used electrophoretic mobility shift assays and DNase I
footprint analyses to demonstrate that the nucleoid proteins FIS and IHF each
bind multiple sites within the acs regulatory region, that FIS competes
successfully with CRP for binding to their overlapping and neighbouring sites
and that IHF binds independently of either FIS or CRP. Using in vitro
transcription assays, we demonstrated that FIS and IHF independently reduce
CRP-dependent acs transcription. Using in vivo reporter assays, we showed that
disruption of DNA sites for FIS or deletion of DNA sites for IHF increases acs
transcription. We propose that FIS and IHF each function directly as
anti-activators of CRP, each working independently at different times during
growth to set the levels of CRP-dependent acs transcription.

PMID: 14651625 [PubMed - indexed for MEDLINE]

31: FEMS Microbiol Rev. 2003 Dec;27(5):559-92. 

Phylogeny of the bacterial superfamily of Crp-Fnr transcription regulators:
exploiting the metabolic spectrum by controlling alternative gene programs.

Korner H, Sofia HJ, Zumft WG.

Lehrstuhl fur Mikrobiologie, Universitat Karlsruhe, PF 6980, D-76128 Karlsruhe,
Germany.

The Crp-Fnr regulators, named after the first two identified members, are
DNA-binding proteins which predominantly function as positive transcription
factors, though roles of repressors are also important. Among over 1200 proteins
with an N-terminally located nucleotide-binding domain similar to the cyclic
adenosine monophosphate (cAMP) receptor protein, the distinctive additional
trait of the Crp-Fnr superfamily is a C-terminally located helix-turn-helix
motif for DNA binding. From a curated database of 369 family members exhibiting
both features, we provide a protein tree of Crp-Fnr proteins according to their
phylogenetic relationships. This results in the assembly of the regulators ArcR,
CooA, CprK, Crp, Dnr, FixK, Flp, Fnr, FnrN, MalR, NnrR, NtcA, PrfA, and YeiL and
their homologs in distinct clusters. Lead members and representatives of these
groups are described, placing emphasis on the less well-known regulators and
target processes. Several more groups consist of sequence-derived proteins of
unknown physiological roles; some of them are tight clusters of highly similar
members. The Crp-Fnr regulators stand out in responding to a broad spectrum of
intracellular and exogenous signals such as cAMP, anoxia, the redox state,
oxidative and nitrosative stress, nitric oxide, carbon monoxide, 2-oxoglutarate,
or temperature. To accomplish their roles, Crp-Fnr members have intrinsic
sensory modules allowing the binding of allosteric effector molecules, or have
prosthetic groups for the interaction with the signal. The regulatory
adaptability and structural flexibility represented in the Crp-Fnr scaffold has
led to the evolution of an important group of physiologically versatile
transcription factors.

Publication Types:
    Review

PMID: 14638413 [PubMed - indexed for MEDLINE]

32: J Bacteriol. 2003 Dec;185(23):6852-9. 

pH-Dependent modulation of cyclic AMP levels and GadW-dependent repression of
RpoS affect synthesis of the GadX regulator and Escherichia coli acid
resistance.

Ma Z, Richard H, Foster JW.

Department of Microbiology and Immunology, University of South Alabama College
of Medicine, Mobile, Alabama 36688, USA.

Extreme acid resistance is a remarkable property of virulent and avirulent
Escherichia coli. The ability to resist environments in which the pH is 2.5 and
below is predicted to contribute significantly to the survival of E. coli during
passage through the gastric acid barrier. One acid resistance system imports
glutamate from acidic environments and uses it as a proton sink during an
intracellular decarboxylation reaction. Transcription of the genes encoding the
glutamate decarboxylases and the substrate-product antiporter required for this
system is induced under a variety of conditions, including the stationary phase
and a low pH. Acid induction during log-phase growth in minimal medium appears
to occur through multiple pathways. We recently demonstrated that GadE, the
essential activator of the genes, was itself acid induced. In this report we
present evidence that there is a regulatory loop involving cross-repression of
two AraC-like regulators, GadX and GadW, that can either assist or interfere
with GadE activation of the gad decarboxylase and antiporter genes, depending on
the culture conditions. Balancing cross-repression appears to be dependent on
cAMP and the cAMP regulator protein (CRP). The control loop involves the GadX
protein repressing the expression of gadW and the GadW protein repressing or
inhibiting RpoS, which is the alternative sigma factor that drives transcription
of gadX. CRP and cAMP appear to influence GadX-GadW cross-repression from
outside the loop by inhibiting production of RpoS. We found that GadW represses
the decarboxylase genes in minimal medium and that growth under acidic
conditions lowers the intracellular cAMP levels. These results indicate that CRP
and cAMP can mediate pH control over gadX expression and, indirectly, expression
of the decarboxylase genes. Mutational or physiological lowering of cAMP levels
increases the level of RpoS and thereby increases the production of GadX. Higher
GadX levels, in turn, repress gadW and contribute to induction of the gad
decarboxylase genes. The presence of multiple pH control pathways governing
expression of this acid resistance system is thought to reflect different
environmental routes to a low pH.

PMID: 14617649 [PubMed - indexed for MEDLINE]

33: Genome Res. 2003 Nov;13(11):2381-90. 

A biophysical approach to transcription factor binding site discovery.

Djordjevic M, Sengupta AM, Shraiman BI.

Department of Physics, Columbia University, New York, New York 10025, USA.

Identification of transcription factor binding sites within regulatory segments
of genomic DNA is an important step toward understanding of the regulatory
circuits that control expression of genes. Here, we describe a novel
bioinformatics method that bases classification of potential binding sites
explicitly on the estimate of sequence-specific binding energy of a given
transcription factor. The method also estimates the chemical potential of the
factor that defines the threshold of binding. In contrast with the widely used
information-theoretic weight matrix method, the new approach correctly describes
saturation in the transcription factor/DNA binding probability. This results in
a significant improvement in the number of expected false positives,
particularly in the ubiquitous case of low-specificity factors. In the strong
binding limit, the algorithm is related to the "support vector machine" approach
to pattern recognition. The new method is used to identify likely genomic
binding sites for the E. coli transcription factors collected in the DPInteract
database. In addition, for CRP (a global regulatory factor), the likely
regulatory modality (i.e., repressor or activator) of predicted binding sites is
determined.

PMID: 14597652 [PubMed - indexed for MEDLINE]

34: Res Microbiol. 2003 Sep;154(7):510-20. 

Comparison of the structure and regulation of the udp gene of Vibrio cholerae,
Yersinia pseudotuberculosis, Salmonella typhimurium, and Escherichia coli.

Zolotukhina M, Ovcharova I, Eremina S, Errais Lopes L, Mironov AS.

State Research Institute of Genetics and Selection of Industrial Microorganisms,
113545 Moscow, Russia.

The nucleotide sequences of the udp gene encoding uridine phosphorylase of
Yersinia pseudotuberculosis and Vibrio cholerae are presented and compared with
the udp sequences of Salmonella typhimurium and Escherichia coli. Both genes
contain 759 bases and encode a 253 amino acid polypeptide, which is the same as
for E. coli and S. typhimurium. The amino acid sequence derived from S.
typhimurium gene was more similar to the derived E. coli sequence, with only a 7
amino acid difference. The Y. pseudotuberculosis and V. cholerae uridine
phosphorylases presented a higher degree of divergence in their amino acid
sequence as compared to the corresponding E. coli amino acid sequence, with 20
and 64 changes, respectively. The promoter regions of the udp gene for S.
typhimurium (udpPSt), Y. pseudotuberculosis (udpPYp) and V. cholerae (udpPVc)
were identified by primer extension analysis. Comparative analysis of the udpP
promoter region from Y. pseudotuberculosis, V. cholerae, S. typhimurium and E.
coli revealed that location, spacing and orientation of putative binding sites
for CRP protein are highly conserved, whereas CytR protein recognition sequences
of udpPYp and udpPVc deviate markedly from the E. coli and S. typhimurium CytR
binding site. In vitro studies demonstrated that the CytR protein from E. coli
shows different affinity for each promoter region analyzed. According to this,
the degree of CytR derepression after introduction of heterologous promoters
into E. coli cells is different.

PMID: 14499937 [PubMed - indexed for MEDLINE]

35: J Bacteriol. 2003 Sep;185(17):5148-57. 

Cyclic AMP receptor protein-dependent activation of the Escherichia coli acsP2
promoter by a synergistic class III mechanism.

Beatty CM, Browning DF, Busby SJ, Wolfe AJ.

Department of Microbiology and Immunology, Stritch School of Medicine, Loyola
University Chicago, Maywood, IL 60153, USA.

The cyclic AMP receptor protein (CRP) activates transcription of the Escherichia
coli acs gene, which encodes an acetate-scavenging enzyme required for fitness
during periods of carbon starvation. Two promoters direct transcription of acs,
the distal acsP1 and the proximal acsP2. In this study, we demonstrated that
acsP2 can function as the major promoter and showed by in vitro studies that CRP
facilitates transcription by "focusing" RNA polymerase to acsP2. We proposed
that CRP activates transcription from acsP2 by a synergistic class III
mechanism. Consistent with this proposal, we showed that CRP binds two sites,
CRP I and CRP II. Induction of acs expression absolutely required CRP I, while
optimal expression required both CRP I and CRP II. The locations of these DNA
sites for CRP (centered at positions -69.5 and -122.5, respectively) suggest
that CRP interacts with RNA polymerase through class I interactions. In support
of this hypothesis, we demonstrated that acs transcription requires the surfaces
of CRP and the C-terminal domain of the alpha subunit of RNA polymerase
holoenzyme (alpha-CTD), which is known to participate in class I interactions:
activating region 1 of CRP and the 287, 265, and 261 determinants of the
alpha-CTD. Other surface-exposed residues in the alpha-CTD contributed to acs
transcription, suggesting that the alpha-CTD may interact with at least one
protein other than CRP.

PMID: 12923087 [PubMed - indexed for MEDLINE]

36: Biotechnol Lett. 2003 Feb;25(3):191-7. 

Molecular characterization of polyphosphate kinase (ppk) gene from Serratia
marcescens.

Lee SJ, Song OR, Lee YC, Choi YL.

Division of Biotechnology, Faculty of Natural Resources and Life Science, Dong-A
University, Busan 604-714, Korea.

To understand the mechanism of phosphate accumulation, a gene encoding
polyphosphate kinase (PPK) was cloned from the genomic library of Serratia
marcescens by Southern hybridization. From the nucleotide sequence of a 4 kb DNA
fragment, an open reading frame of 2063 nucleotides was identified encoding a
protein of 686 amino acids with molecular mass of 70 kDa. The potential CRP
binding site and pho box sequence were found upstream of the putative promoter
in the regulatory region. The expression of PPK resulted in the formation of
inclusion bodies and the product was active at low temperature. The E. coli
strain harboring plasmid pSPK5 with ppk gene increased enzyme activity of
polyphosphate kinase, resulting in increased accumulation of polyphosphate in E.
coli.

PMID: 12882570 [PubMed - indexed for MEDLINE]

37: J Bacteriol. 2003 Aug;185(15):4644-7. 

Transcriptional expression of Escherichia coli glutamate-dependent acid
resistance genes gadA and gadBC in an hns rpoS mutant.

Waterman SR, Small PL.

Division of Human Immunology, Hanson Institute, Institute of Medical and
Veterinary Science, Adelaide, South Australia, 5000, Australia.
scott.waterman@imvs.sa.gov.au

Resistance to being killed by acidic environments with pH values lower than 3 is
an important feature of both pathogenic and nonpathogenic Escherichia coli. The
most potent E. coli acid resistance system utilizes two isoforms of glutamate
decarboxylase encoded by gadA and gadB and a putative
glutamate:gamma-aminobutyric acid antiporter encoded by gadC. The gad system is
controlled by two repressors (H-NS and CRP), one activator (GadX), one
repressor-activator (GadW), and two sigma factors (sigma(S) and sigma(70)). In
contrast to results of previous reports, we demonstrate that gad transcription
can be detected in an hns rpoS mutant strain of E. coli K-12, indicating that
gad promoters can be initiated by sigma(70) in the absence of H-NS.

PMID: 12867478 [PubMed - indexed for MEDLINE]

38: Mol Microbiol. 2003 Aug;49(3):823-32. 

RcsCDB His-Asp phosphorelay system negatively regulates the flhDC operon in
Escherichia coli.

Francez-Charlot A, Laugel B, Van Gemert A, Dubarry N, Wiorowski F,
Castanie-Cornet MP, Gutierrez C, Cam K.

Laboratoire de Microbiologie et de Genetique Moleculaire, Centre National de la
Recherche Scientifique, Toulouse, France.

The genes involved in flagellum synthesis, motility and chemotaxis in
Escherichia coli are expressed in a hierarchical fashion. At the top of the
hierarchy lies the master regulator FlhDC, required for the expression of the
whole set of genes. The operon flhDC is controlled by numerous regulators
including H-NS, CRP, EnvZ/OmpR, QseBC and LrhA. In the present work, we report
that the flhDC operon is also negatively regulated by the His-Asp phosphorelay
system RcsCDB. The regulation is potentiated by the RcsB cofactor RcsA. Genetic
analysis indicates that an RcsAB box, located downstream of the promoter, is
required for the regulation. The binding of RcsB and RcsA to this site was
demonstrated by gel retardation and DNase I protection assays. In addition,
mutation analysis suggests that RcsA-specific determinants lie in the right part
of the 'RcsAB box'.

PMID: 12864862 [PubMed - indexed for MEDLINE]

39: FEMS Microbiol Lett. 2003 Jul 15;224(1):127-32. 

Vitreoscilla hemoglobin promoter is not responsive to nitrosative and oxidative
stress in Escherichia coli.

Frey AD, Koskenkorva T, Kallio PT.

Institute of Biotechnology, ETH Zurich, CH-8093 Zurich, Switzerland.
afrey@biotech.biol.ethz.ch

The Vitreoscilla hemoglobin gene (vhb) is expressed under oxygen-limited
conditions via an FNR-dependent mechanism. Furthermore, cAMP-CRP has been
implicated in its regulation. Recently, VHb protein has been reported to protect
a heterologous host from nitrosative stress. In this study we analyzed the
regulation of the Vitreoscilla hemoglobin promoter (Pvhb) in Escherichia coli
under nitrosative and oxidative stress conditions. Our results show
unambiguously that expression of neither VHb nor chloramphenicol
acetyltransferase under the control of Pvhb is induced under the experimental
conditions used. Thus, a clear discrepancy between in vivo function, i.e.
protection against nitrosative stress, and regulation of gene expression is
obvious. The regulation of Pvhb reported here is in clear contrast to the
expression pattern of flavohemoglobins from various microorganisms, which are
generally induced by nitrosative stress. However, the length of Pvhb is only 146
bp and therefore, we cannot rule out that additional regulatory sequences may be
located in the upstream region of Pvhb.

PMID: 12855179 [PubMed - indexed for MEDLINE]

40: Mol Microbiol. 2003 Jul;49(1):1-9. 

Control of rpoS transcription in Escherichia coli and Pseudomonas: why so
different?

Venturi V.

Bacteriology Group, International Centre for Genetic Engineering and
Biotechnology, Area Science Park, Padriciano 99, 34012 Trieste, Italy.
venturi@icgeb.org

In Escherichia coli, the stationary phase alternative sigma factor sigmas
controls the expression of genes involved cell survival in response to cessation
of growth (stationary phase) and provides cross-protection to various stresses.
Levels of sigmas increase dramatically at the onset of stationary phase and are
regulated at the transcriptional, post-transcriptional and post-translational
level, making this one of the most complex regulatory systems in bacteria. The
basic mechanisms for the control of translation and sigmas proteolysis have been
understood. However, studies on the transcriptional control in E. coli lag
behind and are controversial. The cAMP-CRP complex and the two component
BarA/UvrY system have been implicated and, ppGpp and polyphosphate appear to
have a signalling role. sigmas has also been reported to be a general stress
regulator in the fluorescent pseudomonads (Pseudomonas aeruginosa, P.
fluorescens and P. putida) and recent studies on sigmas regulation highlight
that transcriptional regulation in these bacteria apparently plays a major role.
Global regulatory systems, the GacA/GacS two component system and quorum sensing
all affect rpoS expression, as does the TetR family PsrA regulator that directly
binds to- and activates the rpoS promoter in stationary phase. This striking
difference in regulation between E. coli and Pseudomonas can be partly
attributed to the differences in the functional role of sigmas in the two
bacterial species. This report will review mainly recent studies on rpoS
transcriptional regulation and will try to rationalize the current knowledge
into a working model.

Publication Types:
    Review
    Review, Tutorial

PMID: 12823806 [PubMed - indexed for MEDLINE]

41: Proteomics. 2003 May;3(5):647-57. 

Dissecting DNA-protein and protein-protein interactions involved in bacterial
transcriptional regulation by a sensitive protein array method combining a
near-infrared fluorescence detection.

Snapyan M, Lecocq M, Guevel L, Arnaud MC, Ghochikyan A, Sakanyan V.

Laboratoire de Biotechnologie, FRE-CNRS 2230 Biocatalyse, Universite de Nantes,
Nantes, France.

The protein array methodology is used to study DNA-protein and protein-protein
interactions governing gene expression from the Bacillus stearothermophilus
PargCo promoter-operator region. Using probes labelled with near-infrared
fluorescence dyes with exitation characteristics close to 700 or 800 nm, it is
possible to detect signals from proteins (purified or non-purified in
Escherichia coli cell extracts) immobilised on a nitrocellulose membrane with a
high sensitivity (almost 12 amol of a spotted protein for protein-DNA
interactions). Protein array data are confirmed by other methods indicating that
molecular interactions of the order 10(-7) M can be monitored with the proposed
protein array approach. We show that the PargCo region is a target for binding
at least three types of regulatory proteins, ArgR repressors from thermophilic
bacteria, the E. coli RNA polymerase alpha subunit and cyclic AMP binding
protein CRP. We also demonstrate that the high strength of the PargC promoter is
related to an upstream element that binds to the E. coli RNA polymerase alpha
subunit.

PMID: 12748944 [PubMed - indexed for MEDLINE]

42: J Biol Chem. 2003 Jul 25;278(30):27575-85. Epub 2003 May 13. 

Regulation of the mhp cluster responsible for 3-(3-hydroxyphenyl)propionic acid
degradation in Escherichia coli.

Torres B, Porras G, Garcia JL, Diaz E.

Department of Molecular Microbiology, Centro de Investigaciones Biologicas,
Consejo Superior de Investigaciones Cientificas, 28040 Madrid, Spain.

The mhp gene cluster from Escherichia coli constitutes a model system to study
bacterial degradation of 3-(3-hydroxyphenyl)propionic acid (3HPP). In this work
the regulation of the inducible mhp catabolic genes has been studied by genetic
and biochemical approaches. The Pr and Pa promoters, which control the
expression of the divergently transcribed mhpR regulatory gene and mhp catabolic
genes, respectively, show a peculiar arrangement leading to transcripts that are
complementary at their 5'-ends. By using Pr-lacZ and Pa-lacZ translational
fusions and gel retardation assays, we have shown that the mhpR gene product
behaves as a 3HPP-dependent activator of the Pa promoter, being the expression
from Pr constitutive and MhpR-independent. DNase I footprinting experiments and
mutational analysis mapped an MhpR-protected region, centered at position -58
with respect to the Pa transcription start site, which is indispensable for MhpR
binding and in vivo activation of the Pa promoter. Superimposed in the specific
MhpR-mediated regulation of the Pa promoter, we have observed a strict
catabolite repression control carried out by the cAMP receptor protein (CRP)
that allows expression of the mhp catabolic genes when the preferred carbon
source (glucose) is not available and 3HPP is present in the medium. Gel
retardation assays revealed that the specific activator, MhpR, is essential for
the binding of the second activator, CRP, to the Pa promoter. Such peculiar
synergistic transcription activation has not yet been observed in other aromatic
catabolic pathways, and the MhpR activator becomes the first member of the IclR
family of transcriptional regulators that is indispensable for recruiting CRP to
the target promoter.

PMID: 12748194 [PubMed - indexed for MEDLINE]

43: Biochemistry. 2003 May 6;42(17):4809-18. 

Determinants of DNA bending in the DNA-cyclic AMP receptor protein complexes in
Escherichia coli.

Lin SH, Lee JC.

Department of Human Biological Chemistry and Genetics, The University of Texas
Medical Branch at Galveston, Galveston, Texas 77555-1055, USA.

The activated Escherichia coli cAMP receptor protein, CRP, is capable of
regulating the expression of more than 20 genes by binding to specific DNA
sites. DNA bending is an important structural feature that has been observed in
the regulatory mechanism of gene expression by CRP. On the basis of the results
of the fluorescence energy transfer study of the gal P1 promoter, gal bends
asymmetrically upon binding to CRP, although DNA bends symmetrically in the
CRP-lac complex. The flanking sequence proximal to the TGTGA motif is involved
in a sharper bend than the other side with an overall bending angle of
approximately 90-125 degrees, without wrapping around the CRP molecule. To
understand the factors that control the symmetry in DNA bending, a series of DNA
sequences was tested to dissect the contribution of half-sites and flanking
sequences, using the natural gal P1 and lac P1 sequences as initial targets. The
extent of DNA bending induced by CRP was monitored by the difference in
fluorescence anisotropy between free DNA and the DNA-CRP complex. The extent of
bending was sequence-dependent, and most importantly, the symmetry of bending
was a function of the symmetry of the DNA sequence. For example, in the lac
promoter the two binding half-sites (TGTGA and TCACT) were almost symmetric as
an inverted repeat. The recognition F-helices of the two CRP subunits would bind
to these half-sites with a 2-fold symmetry. The flanking sequences (ATAAA and
CATTA) were almost identical mirror images. Thus, they are expected to bend in a
similar manner. Finally, the sequence symmetry properties of a series of natural
CRP promoters were analyzed. A strong tendency for symmetry sequence was encoded
in class I promoter sites but not in class II promoter sites. Results from this
analysis support the conclusion that the geometry of the CRP-DNA complex plays a
major role in determining the molecular mechanism in gene transcription.

PMID: 12718521 [PubMed - indexed for MEDLINE]

44: Biochemistry. 2003 Apr 8;42(13):3812-25. 

Role of protein-protein bridging interactions on cooperative assembly of
DNA-bound CRP-CytR-CRP complex and regulation of the Escherichia coli CytR
regulon.

Chahla M, Wooll J, Laue TM, Nguyen N, Senear DF.

Department of Molecular Biology and Biochemistry, University of California,
Irvine, California 92697, USA.

The unlinked operons that comprise the Escherichia coli CytR regulon are
controlled coordinately through interactions between two gene regulatory
proteins, the cAMP receptor protein (CRP) and the cytidine repressor (CytR).
CytR controls the balance between CRP-mediated recruitment and activation of RNA
polymerase and transcriptional repression. Cooperative interactions between
CytR, when bound to an operator (CytO) located upstream of a CytR-regulated
promoter, and CRP, when bound to flanking tandem promoters, are critical to the
regulatory role of CytR. When CytR binds cytidine, cooperativity is reduced
resulting in increased transcriptional activity. However, this cytidine-mediated
effect varies among promoters, suggesting that coupling between cytidine binding
to CytR and CytR-CRP association is sensitive to promoter structure. To
investigate the chemical and structural basis for these effects, we investigated
how cytidine binding affects association between CytR and CRP in solution and
how it affects the binding of CytR deletion mutants lacking the DNA binding HTH
domain, with tandem CRP dimers bound to either udpP or deoP2. Deletion mutants
that, as we show here, retain the native functions of the allosteric,
inducer-binding domain but do not bind DNA were expressed and purified. We refer
to these as Core domain. Despite only weak association between CytR and CRP in
solution, our results demonstrate the formation of a relatively stable complex
in which the Core domain forms a protein bridge between tandem CRP dimers when
bound to either udpP or deoP2. The DeltaG(o) for bridge complex formation is
about -7.8 kcal/mol. This is well in excess of that required to account for
cooperativity (-2.5 to -3 kcal/mol). The bridge complexes are significantly
destabilized by cytidine binding, and to the same extent in both promoter
complexes (DeltaDeltaG(o) approximately +2 kcal/mol). Even with this
destabilization, DeltaG(o) for bridge complex formation by cytidine-liganded
Core domain is still sufficient by itself to account for cooperativity. These
findings demonstrate that direct coupling between cytidine binding to CytR and
CytR-CRP association does not account for promoter-specific effects on
cooperativity. Instead, cytidine binding must induce a CytR conformation that is
more rigid or in some other way less tolerant of the variation in the geometric
arrangement of operator sites between different promoters.

PMID: 12667072 [PubMed - indexed for MEDLINE]

45: Eur J Biochem. 2003 Apr;270(7):1413-23. 

Steady-state and time-resolved fluorescence studies of conformational changes
induced by cyclic AMP and DNA binding to cyclic AMP receptor protein from
Escherichia coli.

Polit A, Blaszczyk U, Wasylewski Z.

Department of Physical Biochemistry, Faculty of Biotechnology, Jagiellonian
University, Krakow, Poland.

cAMP receptor protein (CRP), allosterically activated by cAMP, regulates the
expression of several genes in Escherichia coli. As binding of cAMP leads to
undefined conformational changes in CRP, we performed a steady-state and
time-resolved fluorescence study to show how the binding of the ligand
influences the structure and dynamics of the protein. We used CRP mutants
containing a single tryptophan residue at position 85 or 13, and fluorescently
labeled with 1,5-I-AEDANS attached to Cys178. Binding of cAMP in the CRP-(cAMP)2
complex leads to changes in the Trp13 microenvironment, whereas its binding in
the CRP-(cAMP)4 complex alters the surroundings of Trp85. Time-resolved
anisotropy measurements indicated that cAMP binding in the CRP-(cAMP)2 complex
led to a substantial increase in the rotational mobility of the Trp13 residue.
Measurement of fluorescence energy transfer (FRET) between labeled Cys178 and
Trp85 showed that the binding of cAMP in the CRP-(cAMP)2 complex caused a
substantial increase in FRET efficiency. This indicates a decrease in the
distance between the two domains of the protein from 26.6 A in apo-CRP to 18.7 A
in the CRP-(cAMP)2 complex. The binding of cAMP in the CRP-(cAMP)4 complex
resulted in only a very small increase in FRET efficiency. The average distance
between the two domains in CRP-DNA complexes, possessing lac, gal or ICAP
sequences, shows an increase, as evidenced by the increase in the average
distance between Cys178 and Trp85 to approximately 20 A. The spectral changes
observed provide new structural information about the cAMP-induced allosteric
activation of the protein.

PMID: 12653996 [PubMed - indexed for MEDLINE]

46: J Bacteriol. 2003 Apr;185(7):2243-50. 

The ascorbate transporter of Escherichia coli.

Zhang Z, Aboulwafa M, Smith MH, Saier MH Jr.

Division of Biological Sciences, University of California at San Diego, La
Jolla, California 92093-0116, USA.

The sgaTBA genes of Escherichia coli encode a putative 12-transmembrane
alpha-helical segment (12 TMS) transporter, an enzyme IIB-like protein and an
enzyme IIA-like protein of the phosphotransferase system (PTS), respectively. We
show that all three proteins as well as the energy-coupling PTS proteins, enzyme
I and HPr, are required for the anaerobic utilization and uptake of L-ascorbate
in vivo and its phosphoenolpyruvate-dependent phosphorylation in vitro. The
transporter exhibits an apparent K(m) for L-ascorbate of 9 micro M and is highly
specific. The sgaTBA genes are regulated at the transcriptional level by the
yjfQ gene product, as well as by Crp and Fnr. The yjfR gene product is essential
for L-ascorbate utilization and probably encodes a cytoplasmic L-ascorbate
6-phosphate lactonase. We conclude that SgaT represents a novel prototypical
enzyme IIC that functions with SgaA and SgaB to allow phosphoryl transfer from
HPr(his-P) to L-ascorbate via the phosphoryl transfer pathway: [pathway: see
text].

PMID: 12644495 [PubMed - indexed for MEDLINE]

47: Microbiology. 2003 Mar;149(Pt 3):715-28. 

Autoinducer 2 activity in Escherichia coli culture supernatants can be actively
reduced despite maintenance of an active synthase, LuxS.

Hardie KR, Cooksley C, Green AD, Winzer K.

Institute of Infections and Immunity, Queen's Medical Centre, C-Floor, West
Block, Nottingham NG7 2UH, UK. kim.hardie@nottingham.ac.uk

Production of the signalling molecule (autoinducer-2) synthesized by LuxS has
been proposed to be pivotal to a universal mechanism of inter-species bacterial
cell-cell communication (quorum sensing); however recently the function of LuxS
has been noted to be integral to central metabolism since it contributes to the
activated methyl cycle. This paper shows that when Helicobacter pylori LuxS is
overproduced in Escherichia coli, it forms cross-linkable multimers. These
multimers persist at comparable levels after 24 h of growth if glucose is
omitted from the growth medium; however, the levels of extracellular
autoinducer-2 decline (Glucose Retention of AI-2 Levels: GRAIL). Glycerol,
maltose, galactose, ribose and L-arabinose could substitute for glucose, but
lactose, D-arabinose, acetate, citrate and pyruvate could not. Mutations in (i).
metabolic pathways (glycolytic enzymes eno, pgk, pgm; galactose epimerase; the
Pta-AckA pathway), (ii). sugar transport (pts components, rbs operon, mgl, trg),
and (iii). regulators involved in conventional catabolic repression (crp, cya),
cAMP-independent catabolite repression (creC, fruR, rpoS,) the stringent
response (relA, spoT) and the global carbon storage regulator (csrA) did not
prevent GRAIL. Although the basis of GRAIL remains uncertain, it is clear that
the mechanism is distinct from conventional catabolite repression. Moreover,
GRAIL is not due to inactivation of the enzymic activity of LuxS, since in E.
coli, LuxS contained within stationary-phase cells grown in the absence of
glucose maintains its activity in vitro.

PMID: 12634340 [PubMed - indexed for MEDLINE]

48: J Bacteriol. 2003 Mar;185(6):1895-902. 

Operon structure and regulation of the nos gene region of Pseudomonas stutzeri,
encoding an ABC-Type ATPase for maturation of nitrous oxide reductase.

Honisch U, Zumft WG.

Lehrstuhl fur Mikrobiologie, Universitat Karlsruhe, D-76128 Karlsruhe, Germany.

The synthesis of a functional nitrous oxide reductase requires an assembly
apparatus for the insertion of the prosthetic copper. Part of the system is
encoded by maturation genes located in Pseudomonas stutzeri immediately
downstream of the structural gene for the enzyme. We have studied the
transcriptional organization and regulation of this region and found a nosDFYL
tatE operon structure. In addition to a putative ABC transporter, consisting of
NosD, NosF, and NosY, the operon encodes a Cu chaperone, NosL, and a component
of the Tat translocon, TatE. The nosD operon was activated in response to
anaerobiosis and nitrate denitrification. The membrane-bound regulator NosR was
required for operon expression; in addition, DnrD, a regulator of the Crp-Fnr
family, enhanced expression under anaerobic conditions. This establishes a
likely signal transduction sequence of NO --> DnrD --> nosR/NosR --> nosD
operon. DnrD-dependent expression was also observed for the nnrS operon (located
immediately downstream of the nosD operon), which encodes a putative heme-Cu
protein (NnrS) and a member of the short-chain dehydrogenase family (ORF247).
The NosF protein, encoded within the nosD operon, exhibits sequence similarity
to ABC-type ATPases. It was fused to the Escherichia coli maltose-binding
protein and overexpressed in soluble form. The fusion protein was purified and
shown to have ATPase activity. NosF is the first maturation factor for which a
catalytic function has been demonstrated in vitro.

PMID: 12618453 [PubMed - indexed for MEDLINE]

49: J Bacteriol. 2003 Mar;185(5):1616-23. 

The cyclic AMP-cyclic AMP receptor protein complex regulates activity of the
traJ promoter of the Escherichia coli conjugative plasmid pRK100.

Starcic M, Zgur-Bertok D, Jordi BJ, Wosten MM, Gaastra W, van Putten JP.

Department of Biology, University of Ljubljana, 1000 Ljubljana, Slovenia.

The TraJ protein is a central activator of F-like plasmid conjugal transfer. In
a search for regulators of traJ expression, we studied the possible regulatory
role of the cyclic AMP (cAMP)-cAMP receptor protein (CRP) complex in traJ
transcription using a traJ-lacZ reporter system. A comparison of the enzyme
activities in the wild-type Escherichia coli strain MC4100 with those in cya and
crp mutants indicated that disruption of the formation of the cAMP-CRP complex
negatively influenced the activity of the traJ promoter of the F-like plasmid
pRK100. The defect in the cya mutant was partially restored by addition of
exogenous cAMP. Competitive reverse transcription-PCR performed with RNA
isolated from the wild-type and mutant strains showed that the cAMP-CRP complex
exerted its effect at the level of transcription. Electrophoretic mobility shift
assays with purified CRP demonstrated that there was direct binding of CRP to
the traJ promoter region. DNase I footprint experiments mapped the CRP binding
site around position -67.5 upstream of the putative traJ promoter. Targeted
mutagenesis of the traJ promoter region confirmed the location of the CRP
binding site. Consistent with the demonstrated regulation of TraJ by the
cAMP-CRP complex, mutants with defects in cya or crp exhibited reduced conjugal
transfer from pRK100.

PMID: 12591879 [PubMed - indexed for MEDLINE]

50: J Biol Chem. 2003 Apr 25;278(17):14776-81. Epub 2003 Feb 14. 

Selective regulation of ptsG expression by Fis. Formation of either activating
or repressing nucleoprotein complex in response to glucose.

Shin D, Cho N, Heu S, Ryu S.

Department of Food Science and Technology, School of Agricultural Biotechnology
and Center for Agricultural Biomaterials, Seoul National University, Suwon
441-744, Korea.

Transcription of ptsG encoding glucose-specific permease, enzyme IICB(Glc), in
Escherichia coli is initiated from two promoters, P1 and P2. ptsG transcription
is repressed by Mlc, a glucose-inducible regulator of carbohydrate metabolism.
The regulation of ptsG P1 transcription is also under positive control by cyclic
AMP receptor protein and cyclic AMP complex (CRP.cAMP) as observed in other Mlc
regulon. We report here that Fis, one of the nucleoid-associated proteins, plays
a key role in glucose induction of Mlc regulon. ptsG transcription was induced
when wild-type cells were grown in the presence of glucose. However, in a fis
mutant, the basal level of ptsG transcription was higher but decreased when
cells were grown in the presence of glucose, which implies the possibility of
regulatory interactions among Fis, Mlc, and CRP.cAMP. Footprinting experiments
with various probes and transcription assays revealed that Fis assists both Mlc
repression and CRP.cAMP activation of ptsG P1 through the formation of
Fis.CRP.Mlc or Fis.CRP nucleoprotein complexes at ptsG P1 promoter depending on
the availability of glucose in the growth medium. ptsG P2 transcription was
inhibited by Fis and Mlc. Tighter Mlc repression and enhanced CRP.cAMP
activation of ptsG P1 by Fis enable cells to regulate Mlc regulon efficiently by
selectively controlling the concentration of enzyme IICB(Glc) that modulates Mlc
activity.

PMID: 12588863 [PubMed - indexed for MEDLINE]

51: RNA. 2002 Nov;8(11):1416-27. 

The C-terminal amino acid sequence of nascent peptide is a major determinant of
SsrA tagging at all three stop codons.

Sunohara T, Abo T, Inada T, Aiba H.

Division of Biological Science, Graduate School of Science, Nagoya University,
Chikusa, Nagoya 464-8602, Japan.

Recent studies on endogenous SsrA-tagged proteins have revealed that the tagging
could occur at a position corresponding to the normal termination codon. During
the study of SsrA-mediated Lacl tagging (Abo et al., EMBO J, 2000 19:3762-3769),
we found that a variant Lacl (Lacl deltaC1) lacking the last C-terminal amino
acid residue is efficiently tagged in a stop codon-dependent manner. SsrA
tagging of Lacl deltaC1 occurred efficiently without Lacl binding to the lac
operators at any one of three stop codons. The C-terminal (R)LESG peptide of
Lacl deltaC1 was shown to trigger the SsrA tagging of an unrelated protein (CRP)
when fused to its C terminus. Mass spectrometry analysis of the purified fusion
proteins revealed that SsrA tagging occurs at a position corresponding to the
termination codon. The alteration of the amino acid sequence but not the
nucleotide sequence of the C-terminal portion eliminated the tagging. We also
showed that the tagging-provoking sequences cause an efficient translational
readthrough at UGA but not UAA codons. In addition, we found that C-terminal
dipeptides known to induce an efficient translation readthrough could cause an
efficient tagging at stop codons. We conclude that the amino acid sequence of
nascent polypeptide prior to stop codons is a major determinant for the SsrA
tagging at all three stop codons.

PMID: 12458795 [PubMed - indexed for MEDLINE]

52: Sb Lek. 2001;102(4):489-99. 

[Differences in the dynamics of leptin and cortisol during the non-infectious
stress reaction]

[Article in Czech]

Maruna P, Gurlich R, Marunova M, Frasko R, Chachkhiani I.

Ustav patologicke fyziologie 1. lekarske fakulty Univerzity Karlovy, U nemocnice
5, 120 00 Praha 2, Czech Republic. maruna@lf1.cuni.cz

Leptin is a hormone and acute phase reactant with multiple effects during both
rest and inflammatory period. Effects of leptin in acute phase response cover a
modulation of hypothalamo-pituitoadrenal (HPA) axis, too. In our study we
evaluate the dynamics of leptin and glucocorticoid acute changes in model
situations of infectious and non-infectious inflammatory reaction. PATIENTS AND
METHODS: This study was realized on a group of patients 1--after operation of
carcinoma coli (16 persons), 2--after laparoscopic non-adjustable gastric
banding (13 persons), and patients 3--with development of postoperative
intraabdominal sepsis (22 persons). Plasma levels of leptin, ACTH, cortisol,
TNF-alpha, IL-6, C reactive protein (CRP), and alpha1-antitrypsin (AAT) were
measured from -7 to +3 day related to surgery or 2nd day after a day when signs
of sepsis were occurred. RESULTS: All tested parameters responded to surgical
trauma with elevation 12 h after operation except leptin that elevated +24 h
after surgery. Maximal levels of measured parameters were found 12 h after
surgery (for cortisol), 24 h after surgery (for leptin, TNF-alpha, IL-6), or 36
h after operation (for CRP and AAT). Maximal levels of cortisol after a
resection of coli or maximal levels of leptin after laparoscopic gastric banding
fall to septic range. Other parameters in uncomplicated postoperative period
significantly differed from septic levels on p < 0.01. There wasn't found
statistically significant correlation between leptin and cortisol or between
leptin and ACTH in all groups. DISCUSSION AND CONCLUSION: The elevation of
leptin in postoperative period and during sepsis reflects a different regulation
of this protein in rest period and during systemic inflammatory response. The
inhibitory effect of leptin to HPA axis during stress response was documented in
vitro, however, its physiological importance is not clear, yet. Our study didn't
prove a statistically significant relation between plasma cortisol and leptin.
The different dynamics of leptin and cortisol after surgical trauma shows that
both factors have own specific regulation.

PMID: 12448201 [PubMed - indexed for MEDLINE]

53: J Bacteriol. 2002 Dec;184(24):7001-12. 

Collaborative regulation of Escherichia coli glutamate-dependent acid resistance
by two AraC-like regulators, GadX and GadW (YhiW).

Ma Z, Richard H, Tucker DL, Conway T, Foster JW.

Department of Microbiology and Immunology, University of South Alabama College
of Medicine, Mobile 36688, USA.

An important feature of Escherichia coli pathogenesis is an ability to withstand
extremely acidic environments of pH 2 or lower. This acid resistance property
contributes to the low infectious dose of pathogenic E. coli species. One very
efficient E. coli acid resistance system encompasses two isoforms of glutamate
decarboxylase (gadA and gadB) and a putative glutamate:gamma-amino butyric acid
(GABA) antiporter (gadC). The system is subject to complex controls that vary
with growth media, growth phase, and growth pH. Previous work has revealed that
the system is controlled by two sigma factors, two negative regulators (cyclic
AMP receptor protein [CRP] and H-NS), and an AraC-like regulator called GadX.
Earlier evidence suggested that the GadX protein acts both as a positive and
negative regulator of the gadA and gadBC genes depending on environmental
conditions. New data clarify this finding, revealing a collaborative regulation
between GadX and another AraC-like regulator called GadW (previously YhiW). GadX
and GadW are DNA binding proteins that form homodimers in vivo and are 42%
homologous to each other. GadX activates expression of gadA and gadBC at any pH,
while GadW inhibits GadX-dependent activation. Regulation of gadA and gadBC by
either regulator requires an upstream, 20-bp GAD box sequence. Northern blot
analysis further indicates that GadW represses expression of gadX. The results
suggest a control circuit whereby GadW interacts with both the gadA and gadX
promoters. GadW clearly represses gadX and, in situations where GadX is missing,
activates gadA and gadBC. GadX, however, activates only gadA and gadBC
expression. CRP also represses gadX expression. It does this primarily by
repressing production of sigma S, the sigma factor responsible for gadX
expression. In fact, the acid induction of gadA and gadBC observed when
rich-medium cultures enter stationary phase corresponds to the acid induction of
sigma S production. These complex control circuits impose tight rein over
expression of the gadA and gadBC system yet provide flexibility for inducing
acid resistance under many conditions that presage acid stress.

PMID: 12446650 [PubMed - indexed for MEDLINE]

54: J Appl Microbiol. 2002;93(5):787-93. 

The identification of the transcriptional regulator CRP in Aeromonas hydrophila
JMP636 and its involvement in amylase production and the 'acidic toxicity'
effect.

Kidd SP, Pemberton JM.

School of Biosciences, University of Birmingham, Edgbaston, UK.
s.p.kidd@bham.ac.uk

AIMS: The physiological examination of amylase production by Aeromonas
hydrophila JMP636 and identification of the mechanism of regulation. METHODS AND
RESULTS:Aeromonas hydrophila JMP636 was grown with single, then dual carbon
sources; the growth cycle was followed and amylase activity throughout was
monitored. The levels of cAMP, a known secondary messenger for the regulatory
gene crp, were also examined. Amylase activity was regulated by catabolite
repression. Physiological studies revealed that JMP636 exhibited both diauxic
growth, with two carbon sources, and the 'acid toxicity' effect on glucose. The
crp gene was cloned, expressed and inactivated from the JMP636 chromosome.
Catabolite repression of amylase production and the 'acid toxicity' effect both
require crp and were linked to cAMP levels. CONCLUSIONS: Regulation of amylase
production was predicted to follow the model CRP-mediated cAMP-dependent
Escherichia coli catabolite regulation system. SIGNIFICANCE AND IMPACT OF THE
STUDY: This work provides an understanding of the physiology of the
opportunistic pathogen Aer. hydrophila through identification of the mechanism
of catabolite repression of amylase production and the existence of crp within
this cell. It also provides a broader knowledge of global gene regulation and
suggests regulatory mechanisms of other Aer. hydrophila gene/s.

PMID: 12392524 [PubMed - indexed for MEDLINE]

55: Genetika. 2002 Sep;38(9):1223-34. 

[Functional interrelationship between elements of the Escherichia coli udp gene
promotor responsible for binding regulatory proteins CytR, CRP, and RNA
polymerase]

[Article in Russian]

Zolotukhina MA, Ovcharova IV, Eremina SIu, Errais LL, Mironov AS.

State Research Institute of Genetics and Selection of Industrial Microorganisms,
Moscow, 113545 Russia.

Site-directed mutagenesis was conducted in the regulatory region of the
Escherichia coli udp gene at promoter sites responsible for binding regulatory
proteins CRP and CytR as well as RNA polymerase (the core-promoter containing
the--10 sequence). In mutants with an "improved"--10 region, a partial relief
from the control of the cAMP-CRP transcription activation complex occurred, and
the negative CytR repressor regulation was reduced. In contrast, mutant
promoters with a weak Pribnow block or with a deletion that completely
eliminates the core-promoter exhibited an increased ability to titrate the CytR
protein in vivo. On the other hand, the affinity of CytR for DNA in mutants with
an altered--10 region was the same as in the wild-type udp promoter. After
introduction of mutations affecting binding sites for CRP (CRP1 and CRP2), the
negative effect of the CytR protein on promoter transcription was fully
abolished. The CRP1 binding site was shown to play the main role in the
activation of the promoter by the cAMP-CRP complex, whereas the CRP2 site
participates in the formation of the repressor complex. Mutations in the main
and additional CytR binding sites were isolated and characterized. On the basis
of these data, it is concluded that the modification of each structural element
of the udp regulatory region (binding sites for CytR, CRP, or RNA polymerase)
caused changes in the overall pattern of the promoter regulation.

PMID: 12391883 [PubMed - indexed for MEDLINE]

56: Mol Microbiol. 2002 Oct;46(1):101-11. 

MetR and CRP bind to the Vibrio harveyi lux promoters and regulate luminescence.

Chatterjee J, Miyamoto CM, Zouzoulas A, Lang BF, Skouris N, Meighen EA.

Department of Biochemistry, Room 813, McIntyre Medical Sciences Building, McGill
University, 3655 Promenade Sir William Osler, Montreal, Quebec, H3G 1Y6, Canada.

The induction of luminescence in Vibrio harveyi at the later stages of growth is
controlled by a quorum-sensing mechanism in addition to nutritional signals.
However, the mechanism of transmission of these signals directly to the lux
promoters is unknown and only one regulatory protein, LuxR, has been shown to
bind directly to lux promoter DNA. In this report, we have cloned and sequenced
two genes, crp and metR, coding for the nutritional regulators, CRP (cAMP
receptor protein) and MetR (a LysR homologue), involved in catabolite repression
and methionine biosynthesis respectively. The metR gene was cloned based on a
general strategy to detect lux DNA-binding proteins expressed from a genomic
library, whereas the crp gene was cloned based on its complementation of an
Escherichia coli crp mutant. Both CRP and MetR were shown to bind to lux
promoter DNA, with CRP being dependent on the presence of cAMP. Expression
studies indicated that the two regulators had opposite effects on luminescence:
CRP was an activator and MetR a repressor. Disruption of crp decreased
luminescence by about 1,000-fold showing that CRP is a major activator of
luminescence the same as LuxR, whereas disruption of MetR resulted in activation
of luminescence over 10-fold, confirming its function as a repressor. Comparison
of the levels of the autoinducers involved in quorum sensing excreted by V.
harveyi, and the crp and metR mutants, showed that autoinducer production was
not significantly different, thus indicating that the nutritional signals do not
affect luminescence by changing the levels of the signals required for quorum
sensing. Indeed, the large effects of these nutritional sensors show that
luminescence is controlled by multiple signals related to the environment and
the cell density which must be integrated at the molecular level to control
expression at the lux promoters.

PMID: 12366834 [PubMed - indexed for MEDLINE]

57: Biotechnol Bioeng. 2002 Nov 5;80(3):313-9. 

Metabolic adaptation of Escherichia coli during temperature-induced recombinant
protein production: 1. Readjustment of metabolic enzyme synthesis.

Hoffmann F, Weber J, Rinas U.

Biochemical Engineering Division, GBF German Research Center for Biotechnology,
Mascheroder Weg 1, 38124 Braunschweig, Germany.

The metabolic burden and the stress load resulting from temperature-induced
production of human basic fibroblast growth factor is connected to an increase
in the respiratory activity of recombinant Escherichia coli, thereby reducing
the biomass yield. To study the underlying changes in metabolic enzyme synthesis
rates, the radiolabeled proteom was subjected to two-dimen- sional gel
electrophoresis. After temperature-induction, the cAMP-CRP controlled
dehydrogenases of the pyruvate dehydrogenase complex and the tricarboxylic acid
cycle (LpdA and SdhA) were induced four times, reaching a maximum 1 h after the
temperature upshift. The more abundant tricarboxylic acid cycle dehydrogenases
(Icd and Mdh) were initially produced at reduced rates but regained preshift
rates within 30 min. The adenylate energy charge dropped immediately after the
temperature upshift but recovered within 1 h. Similar profiles in dehydrogenase
synthesis rates and adenylate energy charge were found in a control cultivation
of a strain carrying the "empty" parental expression vector. Although both
strains exhibited significant differences in growth pattern and respiration
rates after the temperature upshift, the adaptation of the energetic state of
the cells and the synthesis of enzymes from the energy-generating catabolic
pathway did not seem to be affected by the strong overproduction of the
recombinant growth factor. In contrast, the synthesis rates of enzymes belonging
to the biosynthetic machinery, e.g., translational elongation factors, decreased
more strongly in the culture synthesizing the recombinant protein. In control
and producing culture, synthesis rates of elongation factors paralleled the
respective growth rate profiles. Thus, cells seem to readjust their metabolic
activities according to their energetic requirements and, if necessary, at the
cost of their biosynthetic capabilities. Copyright 2002 Wiley Periodicals, Inc.
Biotechnol Bioeng 80: 313-319, 2002.

PMID: 12226864 [PubMed - indexed for MEDLINE]

58: J Bacteriol. 2002 Oct;184(19):5240-50. 

fleQ, the gene encoding the major flagellar regulator of Pseudomonas aeruginosa,
is sigma70 dependent and is downregulated by Vfr, a homolog of Escherichia coli
cyclic AMP receptor protein.

Dasgupta N, Ferrell EP, Kanack KJ, West SE, Ramphal R.

Department of Medicine/Infectious Diseases, University of Florida, Gainesville,
Florida 32610, USA.

The flagellar transcriptional regulator FleQ appears to be the highest-level
regulator in the hierarchical regulatory cascade of flagellar biogenesis in
Pseudomonas aeruginosa. Except for the posttranslational downregulation of FleQ
activity by FleN, an antiactivator, not much is known about the regulation of
the fleQ gene or its gene product. Some FleQ homologs in other bacterial species
either are positively regulated by another regulator (e.g., CtrA, the master
regulator regulating FlbD in Caulobacter crescentus) or are expressed from a
sigma70-dependent promoter (e.g., FlgR of Helicobacter pylori). In this study we
demonstrated that Vfr, an Escherichia coli CRP homolog known to function as an
activator for various genes, including lasR, regA, and toxA, in P. aeruginosa,
is capable of repressing fleQ transcription by binding to its consensus sequence
in the fleQ promoter. In a DNase I footprint assay, purified Vfr protected the
sequence 5'-AATTGACTAATCGTTCACATTTG-3'. When this putative Vfr binding site in
the fleQ promoter was mutated, Vfr was unable to bind the fleQ promoter fragment
and did not repress fleQ transcription effectively. Primer extension analysis of
the fleQ transcript revealed two transcriptional start sites, t1 and t2, that
map within the Vfr binding site. A putative -10 region (TAAAAT) for the t2
transcript, with a five-of-six match with the E. coli sigma70 binding consensus,
overlaps with one end of the Vfr binding site. A 4-bp mutation and an 8-bp
mutation in this -10 region markedly reduced the activity of the fleQ promoter.
The same mutations led to the disappearance of the 203-nucleotide fleQ
transcript in an in vitro transcription assay. Vfr probably represses fleQ
transcription by binding to the Vfr binding site in the fleQ promoter and
preventing the sigma factor from binding to the -10 region to initiate
transcription.

PMID: 12218009 [PubMed - indexed for MEDLINE]

59: Mol Microbiol. 2002 Aug;45(3):673-95. 

Genome-wide analysis of deoxyadenosine methyltransferase-mediated control of
gene expression in Escherichia coli.

Oshima T, Wada C, Kawagoe Y, Ara T, Maeda M, Masuda Y, Hiraga S, Mori H.

CREST, JST (Japan Science and Technology).

Deoxyadenosine methyltransferase (Dam) methylates the deoxyadenine residues in
5'-GATC-3' sequences and is important in many cellular processes in Escherichia
coli. We performed a computational analysis of the entire E. coli genome and
confirmed that GATC sequences are distributed unevenly in regulatory regions,
which suggests that Dam might regulate gene transcription. To test this, a
high-density DNA microarray of 4097 E. coli genes was constructed and used to
assess the gene expression profiles of the wild type and the dam-16::kam mutant
strain grown under four different conditions. We also used two-dimensional
electrophoretic analysis of the proteome to assess the protein profiles. The
expression of a large number of genes was affected by the dam deficiency. Genes
involved in aerobic respiration, stress and SOS responses, amino acid metabolism
and nucleotide metabolism were expressed at higher levels in the mutant cells,
especially in aerobic conditions. In contrast, transcription of genes
participating in anaerobic respiration, flagella biosynthesis, chemotaxis and
motility was decreased in the dam mutant strain under both aerobic and low
aerobic conditions. Thus, Dam-controlled genes are involved in adjusting the
metabolic and respiratory pathways and bacterial motility to suit particular
environmental conditions. The promoters of most of these Dam-controlled genes
were also found to contain GATC sequences that overlap with recognition sites
for two global regulators, fumarate nitrate reduction (Fnr) and catabolite
activator protein (CRP). We propose that Dam-mediated methylation plays an
important role in the global regulation of genes, particularly those with Fnr
and CRP binding sites.

PMID: 12139615 [PubMed - indexed for MEDLINE]

60: Genetika. 2002 May;38(5):613-21. 

[Formation of an additional promotor in the regulatory region of the Escherichia
coli udp gene and its structural and functional characterization]

[Article in Russian]

Evdokimova AA, Eremina SIu, Errais LL, Mironov AS.

State Research Institute of Genetics and Selection of Industrial Microorganisms,
Moscow, 113545 Russia.

Structural and functional organization of the mutant udpP18 promoter generated
after the spontaneous deletion of the G base in the -79 position relative to the
start site of transcription from the main (P1) promoter within the regulatory
region of the udp gene was studied. In this mutant, a new, functionally active
promoter (P2) with the start site of transcription in the -64 position that
contained the typical motif 5'-TG-3' located in front of the Pribnow sequence
was formed. The data presented suggest that the expression of the P2 promoter,
unlike that of P1, is not subjected to regulation with participation of the CytR
protein and the cAMP-CRP complex. Results of mutational analysis of the P2
promoter showed that substitutions of the nucleotide G in the -14 position and
nucleotide T in the -15 position significantly diminish the level of
transcription from the P2 promoter. On the basis of these data, it is concluded
that the P2 promoter could be assigned with respect to its characteristics to a
group of promoters with an extended -10 region. The synergistic effect of P1 and
P2 promoters on total expression of the udp gene in the mutant udpP18 was
detected.

PMID: 12068544 [PubMed - indexed for MEDLINE]

61: J Bacteriol. 2002 Jul;184(13):3605-13. 

Differential regulation of twitching motility and elastase production by Vfr in
Pseudomonas aeruginosa.

Beatson SA, Whitchurch CB, Sargent JL, Levesque RC, Mattick JS.

ARC Special Research Centre for Functional and Applied Genomics, Institute for
Molecular Bioscience, University of Queensland, Brisbane, Queensland 4072,
Australia.

Vfr, a homolog of Escherichia coli cyclic AMP (cAMP) receptor protein, has been
shown to regulate quorum sensing, exotoxin A production, and regA transcription
in Pseudomonas aeruginosa. We identified a twitching motility-defective mutant
that carries a transposon insertion in vfr and confirmed that vfr is required
for twitching motility by construction of an independent allelic
deletion-replacement mutant of vfr that exhibited the same phenotype, as well as
by the restoration of normal twitching motility by complementation of these
mutants with wild-type vfr. Vfr-null mutants exhibited severely reduced
twitching motility with barely detectable levels of type IV pili, as well as
loss of elastase production and altered pyocyanin production. We also identified
reduced-twitching variants of quorum-sensing mutants (PAK lasI::Tc) with a
spontaneous deletion in vfr (S. A. Beatson, C. B. Whitchurch, A. B. T. Semmler,
and J. S. Mattick, J. Bacteriol., 184:3598-3604, 2002), the net result of which
was the loss of five residues (EQERS) from the putative cAMP-binding pocket of
Vfr. This allele (VfrDeltaEQERS) was capable of restoring elastase and pyocyanin
production to wild-type levels in vfr-null mutants but not their defects in
twitching motility. Furthermore, structural analysis of Vfr and VfrDeltaEQERS in
relation to E. coli CRP suggests that Vfr is capable of binding both cAMP and
cyclic GMP whereas VfrDeltaEQERS is only capable of responding to cAMP. We
suggest that Vfr controls twitching motility and quorum sensing via independent
pathways in response to these different signals, bound by the same cyclic
nucleotide monophosphate-binding pocket.

PMID: 12057955 [PubMed - indexed for MEDLINE]

62: Microbiology. 2002 May;148(Pt 5):1561-9. 

Effect of vfr mutation on global gene expression and catabolite repression
control of Pseudomonas aeruginosa.

Suh SJ, Runyen-Janecky LJ, Maleniak TC, Hager P, MacGregor CH, Zielinski-Mozny
NA, Phibbs PV Jr, West SE.

Department of Pathobiological Sciences, School of Veterinary Medicine,
University of Wisconsin-Madison, Madison, WI 53706, USA.

Vfr of Pseudomonas aeruginosa is 91% similar to the cAMP receptor protein (CRP)
of Escherichia coli. Based on the high degree of sequence homology between the
two proteins, the question arose whether Vfr had a global regulatory effect on
gene expression for P. aeruginosa as CRP did for E. coli. This report provides
two-dimensional polyacrylamide gel electrophoretic evidence that Vfr is a global
regulator of gene expression in P. aeruginosa. In a vfr101::aacC1 null mutant,
at least 43 protein spots were absent or decreased when compared to the proteome
pattern of the parent strain. In contrast, 17 protein spots were absent or
decreased in the parent strain when compared to the vfr101::aacC1 mutant. Thus,
a mutation in vfr affected production of at least 60 proteins in P. aeruginosa.
In addition, the question whether Vfr and CRP shared similar mechanistic
characteristics was addressed. To ascertain whether Vfr, like CRP, can bind
cAMP, Vfr and CRP were purified to homogeneity and their apparent dissociation
constants (K(d)) for binding to cAMP were determined. The K(d) values were 1.6
microM for Vfr and 0.4 microM for CRP, suggesting that these proteins have a
similar affinity for cAMP. Previously the authors had demonstrated that Vfr
could complement a crp mutation and modulate catabolite repression in E. coli.
This study presents evidence that Vfr binds to the E. coli lac promoter and that
this binding requires the presence of cAMP. Finally, the possible involvement of
Vfr in catabolite repression control in P. aeruginosa was investigated. It was
found that succinate repressed production of mannitol dehydrogenase,
glucose-6-phosphate dehydrogenase, amidase and urocanase both in the parent and
in two vfr null mutants. This implied that catabolite repression control was not
affected by the vfr null mutation. In support of this, the cloned vfr gene
failed to complement a mutation in the P. aeruginosa crc gene. Thus, although
Vfr is structurally similar to CRP, and is a global regulator of gene expression
in P. aeruginosa, Vfr is not required for catabolite repression control in this
bacterium.

PMID: 11988531 [PubMed - indexed for MEDLINE]

63: Microbiology. 2002 May;148(Pt 5):1553-9. 

The regulation of Enzyme IIA(Glc) expression controls adenylate cyclase activity
in Escherichia coli.

Krin E, Sismeiro O, Danchin A, Bertin PN.

Unite de Genetique des Genomes Bacteriens, Institut Pasteur, 28 rue du Docteur
Roux, 75724 Paris Cedex 15, France. ekrin@pasteur.fr

During the last few years, several genes, such as pap, bgl and flhDC, have been
shown to be coregulated by the histone-like nucleoid-structuring (H-NS) protein
and the cyclic AMP-catabolite activator protein (cAMP/CAP) complex, suggesting
an interaction between both systems in the control of some cellular functions.
In this study, the possible effect of H-NS on the cAMP level was investigated.
In a CAP-deficient strain, the presence of an hns mutation results in a strong
reduction in the amount of cAMP, due to a decrease in adenylate cyclase
activity. This is caused by the reduced expression of crr, which encodes the
Enzyme IIA(Glc) of the phosphoenolpyruvate:carbohydrate phosphotransferase
system (PTS), from its specific P2 promoter. This leads to a twofold reduction
in the global amount of Enzyme IIA(Glc), the adenylate cyclase activator,
responsible for the decrease in adenylate cyclase activity observed in the hns
crp strain.

PMID: 11988530 [PubMed - indexed for MEDLINE]

64: Mol Microbiol. 2002 Jan;43(2):323-33. 

Structure of the Lrp-regulated serA promoter of Escherichia coli K-12.

Yang L, Lin RT, Newman EB.

Biology Department, Concordia University, Montreal, Quebec, Canada.

Expression of the Escherichia coli serA gene is activated in vivo by the product
of the lrp gene, leucine-responsive regulatory protein (Lrp), an effect
partially reversed by L-leucine. We show here that serA is transcribed from two
promoters, P1 45 bp upstream of the translation start site, and P2 92 bp further
upstream. Lrp binds to a long AT-rich sequence from -158 to -82 from the start
of the coding region, i.e. upstream of P1 and overlapping P2. It activates
transcription from P1 and represses expression from P2. A second regulator,
cAMP/CRP, activates P2, an effect that is largely inhibited by Lrp, such that
catabolite repressor protein (Crp) and Lrp are rival activators of serA
transcription.

PMID: 11985712 [PubMed - indexed for MEDLINE]

65: J Mol Microbiol Biotechnol. 2002 May;4(3):277-86. 

Nitric oxide signaling and NO dependent transcriptional control in bacterial
denitrification by members of the FNR-CRP regulator family.

Zumft WG.

Lehrstuhl fur Mikrobiologie, Universitat Karlsruhe, Germany.
dj03@rz.uni-karlsruhe.de

Bacterial denitrification transforms nitrate to dinitrogen. The process is
expressed facultatively in response to environmental conditions. Around 50
components make up the denitrification apparatus and its assembly pathways. We
are beginning to understand how exogenous signals provided by oxygen and N
oxides are processed for activating the underlying gene programs. Key signals
are provided by nitrate, nitric oxide, and a low oxygen tension. In the genus
Pseudomonas the nitrate signal is processed by a two component regulatory system
which activates the nar operon encoding respiratory nitrate reductase. Nitric
oxide is not only an essential respiratory substrate of the denitrifying cell
but constitutes in nanomolar concentrations also a key signal for the expression
of nitrite reductase and NO reductase which control cellular NO homeostasis. The
signal pathway in the genera Pseudomonas, Paracoccus and Rhodobacter involves
regulators of the FNR family of transcription factors, which cluster
phylogenetically in a separate subgroup. In contrast, Ralstonia eutropha
requires a sigma-54 dependent regulator of the NtrC family for the expression of
its quinol-dependent NO reductase. Important questions are directed currently at
the mechanism(s) of activation of these transcription factors by NO, and
avoidance of crosstalk with FNR factors at target promoters operating with
identical recognition motifs.

Publication Types:
    Review
    Review, Tutorial

PMID: 11931559 [PubMed - indexed for MEDLINE]

66: Mol Microbiol. 1997 Jul;25(1):27-37. 

Negative autoregulation of the Rhizobium meliloti fixK gene is indirect and
requires a newly identified regulator, FixT.

Foussard M, Garnerone AM, Ni F, Soupene E, Boistard P, Batut J.

Laboratoire de Biologie Moleculaire des Relations Plantes-Microorganismes,
CNRS-INRA, Castanet-Tolosan, France.

fixK genes are crp/fnr homologues that have been discovered in diverse Rhizobium
spp., in which they are usually essential for symbiotic nitrogen fixation. One
recurrent function of fixK genes in rhizobia is to activate the transcription of
operons required for respiration in the microoxic environment of the nodule. In
a similar manner to its Escherichia coli crp and fnr homologues, R. meliloti
fixK regulates its own expression negatively. However, we demonstrate here that
fixK negative autoregulation is not direct and, instead, involves a newly
identified gene, fixT, the expression of which depends on fixK. Inactivation of
fixT resulted in derepression of fixK expression under free-living microoxic
conditions. Furthermore, constitutively expressed fixT strongly repressed
fixK-lacZ expression in the absence of a functional fixK gene. Several lines of
evidence indicate that fixT is active via its protein product FixT. FixT does
not resemble any protein present in databases so far. Nodules induced by a fixT
mutant were Fix+, thus demonstrating that fixT is not essential for symbiotic
nitrogen fixation.

PMID: 11902723 [PubMed - indexed for MEDLINE]

67: J Mol Biol. 2002 Feb 22;316(3):531-46. 

Thermodynamics of E. coli cytidine repressor interactions with DNA: distinct
modes of binding to different operators suggests a role in differential gene
regulation.

Tretyachenko-Ladokhina V, Ross JB, Senear DF.

Department of Molecular Biology and Biochemistry, University of California,
Irvine, CA 92697-3900, USA.

Interactions between the Escherichia coli cytidine repressor protein (CytR) and
its operator sites at the different promoters that comprise the CytR regulon,
play an important role in the regulation of these promoters. The natural
operators are palindromes separated by variable length central spacers (0-9 bp).
We have suggested that this variability affects the flexibility of CytR-DNA
contacts, thereby affecting the critical protein-protein interactions between
CytR and the cAMP receptor protein (CRP) that underlie differential repression
and activation of CytR-regulated genes. To assess this hypothesis, we
investigated the thermodynamics of CytR binding to the natural operator
sequences found in udpP and deoP2. To separate effects due to spacing from
effects due to the differing sequences of the recognition half-sites of these
two operators, we also investigated CytR binding to artificial hybrid operators,
in which the half-site sequences of udpP and deoP2 were exchanged. Thermodynamic
parameters, DeltaS(o), DeltaH(o) and DeltaC(o)(p), were determined by van't Hoff
analysis of CytR binding, monitored by changes in the steady-state fluorescence
anisotropy of dye-conjugated, operator-containing oligonucleotides. Large
differences in thermodynamics were observed that depend primarily on the central
spacer rather than the sequences of the recognition half-sites. Binding to
operators with deoP2 spacing results in a very large, negative DeltaC(o)(p).
Association is strongly favored enthalpically and strongly disfavored
entropically at ambient temperature. By contrast, binding to operators with udpP
spacing results in a small, negative DeltaC(o)(p). Association is weakly favored
both enthalpically and entropically at ambient temperature. A difference of such
magnitude in DeltaDeltaC(o)(p) has not been reported previously for specific
binding of a transcription factor to different sites. The identical salt
dependence of CytR binding to deoP2 and udpP operators indicates that
ion-dependent processes do not contribute significantly to this difference.
Thus, the different thermodynamic effects appear to reflect distinctly different
modes of site-specific DNA binding. We discuss similarities to operator binding
by CytR homologs among LacI family repressors, and we consider how different
CytR binding modes might affect interactions with other components of the gene
regulatory machinery that contribute to differential gene regulation. Copyright
2002 Elsevier Science Ltd.

PMID: 11866516 [PubMed - indexed for MEDLINE]

68: J Mol Biol. 2002 Feb 22;316(3):517-29. 

The C-terminal domains of the RNA polymerase alpha subunits: contact site with
Fis and localization during co-activation with CRP at the Escherichia coli proP
P2 promoter.

McLeod SM, Aiyar SE, Gourse RL, Johnson RC.

Department of Biological Chemistry, UCLA School of Medicine, Los Angeles, CA
90095-1737, USA.

Fis is a versatile transactivator that functions at many different promoters.
Fis activates transcription at the RpoS-dependent proP P2 promoter when bound to
a site that overlaps the minus sign35 hexamer by a mechanism that requires the
C-terminal domain of the alpha subunit of RNA polymerase (alphaCTD). The region
on Fis responsible for activating transcription through the alphaCTD has been
localized to a short beta-turn near the DNA-binding determinant on one subunit
of the Fis homodimer. We report here that Fis-dependent activation of proP P2
transcription requires two discrete regions on the alphaCTD. One region,
consisting of residues 264-265 and 296-297, mediates DNA binding. A second
patch, comprising amino acid residues 271-273, forms a ridge on the surface of
the alphaCTD that we propose interacts with Fis. The accompanying paper shows
that these same regions on alphaCTD are utilized for transcriptional activation
at the rrnB and rrnE P1 promoters by Fis bound to a site upstream of the core
promoter (centered at minus sign71/minus sign72). In addition to stimulation of
proP P2 transcription by Fis, CRP co-activates this promoter when bound to a
remote site upstream from the promoter (centered at -121.5). RNA polymerase
preparations lacking one alphaCTD of the alpha dimer were employed to
demonstrate that the beta'-associated alpha(II)CTD was utilized preferentially
by Fis at proP P2 in the presence and absence of CRP. These experiments define
the overall architecture of the proP P2 initiation complex where Fis and CRP
each function through a different alphaCTD. Copyright 2002 Elsevier Science Ltd.

PMID: 11866515 [PubMed - indexed for MEDLINE]

69: Biotechnol Prog. 2002 Jan-Feb;18(1):6-20. 

Global gene expression differences associated with changes in glycolytic flux
and growth rate in Escherichia coli during the fermentation of glucose and
xylose.

Gonzalez R, Tao H, Shanmugam KT, York SW, Ingram LO.

University of Florida, Department of Microbiology and Cell Science, Gainesville,
FL 32611, USA.

The simplicity of the fermentation process (anaerobic with pH, temperature, and
agitation control) in ethanologenic Escherichia coli KO11 and LY01 makes this an
attractive system to investigate the utility of gene arrays for biotechnology
applications. By using this system, gene expression, glycolytic flux, and growth
rate have been compared in glucose-grown and xylose-grown cells. Although the
initial metabolic steps differ, ethanol yields from both sugars were essentially
identical on a weight basis, and little carbon was diverted to biosynthesis.
Expression of only 27 genes changed by more than 2-fold in both strains. These
included induction of xylose-specific operons (xylE, xylFGHR, and xylAB)
regulated by XylR and the cyclic AMP-CRP system and repression of Mlc-regulated
genes encoding glucose uptake (ptsHIcrr, ptsG) and mannose uptake (manXYZ)
during growth on xylose. However, expression of genes encoding central carbon
metabolism and biosynthesis differed by less than 2-fold. Simple statistical
methods were used to investigate these more subtle changes. The reproducibility
(coefficient of variation of 12%) of expression measurements (mRNA as cDNA) was
found to be similar to that typically observed for in vitro measurements of
enzyme activities. Using Student's t test, many smaller but significant
sugar-dependent changes were identified (p < 0.05 in both strains). A total of
276 genes were more highly expressed during growth on xylose; 307 genes were
more highly expressed with glucose. Slower growth (lower ATP yield) on xylose
was accompanied by decreased expression of 62 genes concerned with the
biosynthesis of small molecules (amino acids, nucleotides, cofactors, and
lipids), transcription, and translation; 5 such genes were expressed at a higher
level. In xylose-grown cells, 90 genes associated with the transport,
catabolism, and regulation of pathways for alternative carbon sources were
expressed at higher levels than in glucose-grown cells, consistent with a
relaxation of control by the cyclic AMP-CRP regulatory system. Changes in
expression of genes encoding the Embden-Meyerhof-Parnas (EMP) pathway were in
excellent agreement with calculated changes in flux for individual metabolites.
Flux through all but one step, pyruvate kinase, was predicted to be higher
during glucose fermentation. Expression levels (glucose/xylose) were higher in
glucose-grown cells for all EMP genes except the isoenzymes encoding pyruvate
kinase (pykA and pykF). Expression of both isoenzymes was generally higher
during xylose fermentation but statistically higher in both strains only for
pykF encoding the isoenzyme activated by fructose-6-phosphate, a key metabolite
connecting pentose metabolism to the EMP pathway. The coordinated changes in
expression of genes encoding the EMP pathway suggest the presence of a common
regulatory system and that flux control within the EMP pathway may be broadly
distributed. In contrast, expression levels for genes encoding the
Pentose-Phosphate pathway did not differ significantly between glucose-grown and
xylose-grown cells.

PMID: 11822894 [PubMed - indexed for MEDLINE]

70: Mol Genet Genomics. 2002 Jan;266(5):865-72. Epub 2001 Nov 21. 

Differential control by IHF and cAMP of two oppositely oriented genes, hpt and
gcd, in Escherichia coli: significance of their partially overlapping regulatory
elements.

Izu H, Ito S, Elias MD, Yamada M.

Department of Biological Biochemistry, Faculty of Agriculture, Yamaguchi
University, Ube, Yamaguchi 755-8505, Japan.

The hpt gene, which encodes hypoxanthine phosphoribosyltransferase, is located
next to, but transcribed in the opposite direction to, the gcd gene, which codes
for a membrane-bound glucose dehydrogenase, at 3.1 min on the Escherichia coli
genome. In their promoter-operator region, putative regulatory elements for
integration host factor (IHF) and for the complex comprising 3', 5'-cyclic AMP
(cAMP) and its receptor protein (CRP) are present, and they overlap the
promoters for hpt and gcd, respectively. The involvement of IHF and cAMP-CRP, as
well as the corresponding putative cis-acting elements, in the expression of the
two genes was investigated by using lacZ operon fusions. In an adenylate
cyclase-deficient strain, addition of cAMP increased the expression of hpt and
reduced the expression of gcd. In agreement with this observation, the
introduction of mutations into the putative binding element for the cAMP-CRP
complex enhanced the expression of gcd. In contrast, mutations introduced into
the putative IHF-binding elements increased the level of hpt expression. Similar
results were obtained with IHF-defective strains. Thus, the expression of the
two genes is regulated in a mutually exclusive manner. Additional experiments
with mutations at the -10 sequence of the gcd promoter suggest that the binding
of RNA polymerase to the hpt promoter interferes with the interaction of RNA
polymerase with the gcd promoter, and vice versa.

PMID: 11810262 [PubMed - indexed for MEDLINE]

71: EMBO J. 2001 Oct 1;20(19):5392-9. 

Repression of deoP2 in Escherichia coli by CytR: conversion of a transcription
activator into a repressor.

Shin M, Kang S, Hyun SJ, Fujita N, Ishihama A, Valentin-Hansen P, Choy HE.

Department of Microbiology, Chonnam University Medical College, 5 Hakdong,
Dongku, Gwangju, South Korea 501-714.

In the deoP2 promoter of Escherichia coli, a transcription activator, cAMP-CRP,
binds at two sites, centered at -41.5 and -93.5 from the start site of
transcription, while a repressor, CytR, binds to a space between the two
cAMP-CRP complexes. The mechanisms for the cAMP-CRP-mediated transcription
activation and CytR-mediated transcription repression were investigated in vitro
using purified components. We classified the deoP2 promoter as a class II
cAMP-CRP-dependent promoter, primarily by the action of cAMP-CRP at the
downstream site. Interestingly, we also found that deoP2 carries an "UP-element"
immediately upstream of the downstream cAMP-CRP site. The UP-element overlaps
with the DNA site for CytR. However, it was observed that CytR functions with
the RNA polymerase devoid of the C-terminal domain of the alpha-subunit as well
as with intact RNA polymerase. The mechanism of repression by CytR proposed in
this study is that the cAMP-CRP bound at -41.5 undergoes an allosteric change
upon direct interaction with CytR such that it no longer maintains a productive
interaction with the N-terminal domain of alpha, but instead acts as a repressor
to interfere with RNA polymerase acting on deoP2.

PMID: 11574471 [PubMed - indexed for MEDLINE]

72: Mol Microbiol. 2001 Sep;41(5):1113-23. 

Identification of TogMNAB, an ABC transporter which mediates the uptake of
pectic oligomers in Erwinia chrysanthemi 3937.

Hugouvieux-Cotte-Pattat N, Blot N, Reverchon S.

Unite Microbiologie et Genetique--composante INSA, UMR UCB-INSA-CNRS 5122, Bat
Louis Pasteur, INSA, 11 Avenue Jean Capelle, F-69621 Villeurbanne Cedex, France.
cotte@insa-lyon.fr

The bacterium Erwinia chrysanthemi, which causes soft rot disease on various
plants, is able to use pectin as a carbon source for growth. Knowledge of the
critical step in pectin catabolism which allows the entry of pectic oligomers
into the cells is scarce. We report here the first example of a transport system
involved in the uptake of pectic oligomers. The TogMNAB transporter of E.
chrysanthemi is a member of the ATP-binding cassette (ABC) superfamily. TogM and
TogN are homologous to the inner membrane components, TogA exhibits the
signature of ABC ATPases and TogB shows similarity with periplasmic
ligand-binding proteins. The TogMNAB transporter is a new member of the
carbohydrate uptake transporter-1 family (CUT1, TC no. 3.1.1), which is
specialized in the transport of complex sugars. The four genes, togM, togN, togA
and togB, are apparently co-transcribed in a large operon which also includes
the pectate lyase gene pelW. The transcription of the tog operon is induced in
the presence of pectic derivatives and is affected by catabolite repression. It
is controlled by the KdgR repressor and the CRP activator. The TogMNAB system is
able to provide Escherichia coli with the ability to transport
oligogalacturonides. In E. chrysanthemi, the TogMNAB system seems to play a
major role in switching on the induction of pectin catabolism. TogB also acts as
a specific receptor for chemotaxis towards oligogalacturonides. The decreased
capacity of maceration of a togM mutant indicates the importance of transport
and/or attraction of oligogalacturonides for E. chrysanthemi pathogenicity.

PMID: 11555291 [PubMed - indexed for MEDLINE]

73: J Bacteriol. 2001 Oct;183(19):5675-83. 

External-pH-dependent expression of the maltose regulon and ompF gene in
Escherichia coli is affected by the level of glycerol kinase, encoded by glpK.

Chagneau C, Heyde M, Alonso S, Portalier R, Laloi P.

Unite de Microbiologie et Genetique, UMR CNRS 5122, Universite Lyon 1, F-69622
Villeurbanne Cedex, France.

The expression of the maltose system in Escherichia coli is regulated at both
transcriptional and translational levels by the pH of the growth medium (pHo).
With glycerol as the carbon source, transcription of malT, encoding the
transcriptional activator of the maltose regulon, is weaker in acidic medium
than in alkaline medium. malT transcription became high, regardless of the pHo,
when glycerol-3-phosphate or succinate was used as the carbon source.
Conversely, malT expression was low, regardless of the pHo, when maltose was
used as the carbon source. The increase in malT transcription, associated with
the pHo, requires the presence of glycerol in the growth medium and the
expression of the glycerol kinase (GlpK). Changes in the level of glpK
transcription had a great effect on malT transcription. Indeed, a glpFKX
promoter-down mutation has been isolated, and in the presence of this mutation,
malT expression was increased. When glpK was expressed from a high-copy-number
plasmid, the glpK-dependent reduced expression of the maltose system became
effective regardless of the pHo. Analysis of this repression showed that a
malTp1 malTp10 promoter, which is independent of the cyclic AMP (cAMP)-cAMP
receptor protein (CRP) complex, was no longer repressed by glpFKX amplification.
Thus, GlpK-dependent repression of the maltose system requires the cAMP-CRP
complex. We propose that the pHo may affect a complex interplay between GlpK,
the phosphotransferase-mediated uptake of glucose, and the adenylate cyclase.

PMID: 11544231 [PubMed - indexed for MEDLINE]

74: Mol Microbiol. 2001 Aug;41(4):911-24. 

The CRP-cAMP complex and downregulation of the glnAp2 promoter provides a novel
regulatory linkage between carbon metabolism and nitrogen assimilation in
Escherichia coli.

Tian ZX, Li QS, Buck M, Kolb A, Wang YP.

National Laboratory of Protein Engineering and Plant Genetic Engineering,
College of Life Sciences, Peking University, Beijing 100871, People's Republic
of China.

In Escherichia coli, glnA (encoding glutamine synthetase) is transcribed from
two promoters (glnAp1 and glnAp2). The glnAp1 is a sigma(70)-dependent promoter
that is activated by the cAMP receptor protein (CRP). Under nitrogen-deficient
growth conditions, glnAp1 is repressed by NtrC-phosphate. The downstream glnAp2
promoter is sigma(54)-dependent and is activated by NtrC-phosphate. Here, we
show that glnAp2 expression is affected by different carbon sources and that the
CRP-cAMP complex inhibits the glnAp2 promoter activity. Primer extension and
KMnO4 footprinting analysis indicate that the inhibitory effect is at the
transcriptional level in vivo. When glnAp2 is activated by NifA, a similar
inhibitory effect by CRP-cAMP is observed. Site-directed mutagenesis and
deletion analysis indicate that the characterized and putative CRP-binding sites
located in the upstream region of the glnAp2 promoter are not essential for the
inhibitory effect. CRP-cAMP inhibits sigma(54)-dependent glnAp2 strongly, by
21-fold. By activating glnAp1 and downregulating glnAp2, the overall effect of
CRP-cAMP on glnA expression is an approximately fourfold reduction, which
correlates with the reduction of gamma-glutamyl transferase activities in the
cells. We propose therefore that a physiological role of CRP-cAMP activation of
glnAp1 is to partially compensate for CRP-cAMP downregulation of glnAp2,
allowing a low but non-negligible level of expression of the important genes
transcribed from it. A novel regulatory linkage between carbon and nitrogen
regulons is proposed.

PMID: 11532153 [PubMed - indexed for MEDLINE]

75: Mol Microbiol. 2001 Aug;41(3):705-16. 

Role of activator site position and a distal UP-element half-site for sigma
factor selectivity at a CRP/H-NS-activated sigma(s)-dependent promoter in
Escherichia coli.

Germer J, Becker G, Metzner M, Hengge-Aronis R.

Institut fur Biologie - Mikrobiologie, Freie Universitat Berlin,
Konigin-Luise-Str. 12-16, 14195 Berlin, Germany.

Transcription initiation by the stress-associated sigma(S)-containing RNA
polymerase holoenzyme (E sigma(S)) in Escherichia coli is often subject to
complex regulation that involves multiple additional regulators and histone-like
proteins. csiD is a stationary phase-inducible sigma(S)-dependent gene in E.
coli that requires activation by cAMP-CRP (bound to a site centred at -68.5
nucleotides upstream of the transcriptional start site) and is positively
modulated by the abundant nucleoid-associated proteins H-NS and Lrp. By shifting
the CRP box to positions between -80.5 and -60.5, we could demonstrate that: (i)
activation is equally helix phase dependent as at classic class I promoters;
(ii) E sigma(S) prefers a CRP box location at -68.5/-70.5, whereas E sigma(70)
is nearly inactive with such an arrangement; and (iii) with the CRP site moved
to -60.5, transcription can be initiated efficiently by both holoenzymes. The
csiD promoter region also contains a distal UP-element half-site located
downstream of the CRP box, as demonstrated by mutational studies, in which this
element was either eliminated or completed to a full UP-element. The UP-element
half-site favours E sigma(S)-mediated expression, whereas with the full
UP-element, nearly wild-type levels of csiD transcription were observed in the
absence of sigma(S). Finally, we show that the two histone-like proteins, H-NS
and Lrp, both act by influencing activation by cAMP-CRP, but do so by different
mechanisms. In particular, H-NS directly or indirectly increases positional
stringency for the CRP binding site. The implications of these findings with
respect to sigma factor selectivity, activation mechanisms used by the two
holoenzymes and the architecture of sigma(S)-dependent promoters are discussed.

PMID: 11532138 [PubMed - indexed for MEDLINE]

76: Prog Nucleic Acid Res Mol Biol. 2001;67:35-63. 

CooA: a heme-containing regulatory protein that serves as a specific sensor of
both carbon monoxide and redox state.

Roberts GP, Thorsteinsson MV, Kerby RL, Lanzilotta WN, Poulos T.

Department of Bacteriology, University of Wisconsin-Madison, 53706, USA.

CooA, the heme-containing carbon monoxide (CO) sensor from the bacterium
Rhodospirillum rubrum, is a transcriptional factor that activates expression of
certain genes in response to CO. As with other heme proteins, CooA is unable to
bind CO when the Fe heme is oxidized, consistent with the fact that some of the
regulated gene products are oxygen-labile. Upon reduction, there is an unusual
switch of protein ligands to the six-coordinate heme and the reduced heme is
able to bind CO. CO binding stabilizes a conformation of the dimeric protein
that allows sequence-specific DNA binding, and transcription is activated
through contacts between CooA and RNA polymerase. CooA is therefore a novel
redox sensor as well as a specific CO sensor. CooA is a homolog of catabolite
responsive protein (CRP), whose transcriptionally active conformation has been
known for some time. The recent solution of the crystal structure of the CO-free
(transcriptionally inactive) form of CooA has allowed insights into the
mechanism by which both proteins respond to their specific small-molecule
effectors.

Publication Types:
    Review

PMID: 11525385 [PubMed - indexed for MEDLINE]

77: J Biol Chem. 2001 Oct 5;276(40):37060-8. Epub 2001 Jul 27. 

Superimposed levels of regulation of the 4-hydroxyphenylacetate catabolic
pathway in Escherichia coli.

Galan B, Kolb A, Garcia JL, Prieto MA.

Department of Molecular Microbiology, Centro de Investigaciones Biologicas,
Consejo Superior de Investigaciones Cientificas, Madrid 28006, Spain.

The regulation of the Pg promoter, which controls the expression of the meta
operon of the 4-hydroxyphenylacetic acid (4-HPA) catabolic pathway of
Escherichia coli W, has been examined through in vivo and in vitro experiments.
By using Pg-lacZ fusions we have demonstrated that Pg is a promoter only
inducible in the stationary phase when cells are grown on glucose as the sole
carbon and energy source. This strict catabolite repression control is mediated
by the cAMP receptor protein (CRP). This event does not require the presence of
the specific HpaR repressor or the 4-HPA permease (HpaX), excluding the
involvement of a typical inducer exclusion mechanism. However, the acetic acid
excreted in the stationary phase by the cells growing in glucose acts as an
overflow metabolite, which can provide the energy to produce cAMP and to adapt
the cells rapidly to the utilization of a new less preferred carbon source such
as the aromatic compounds. Although Pg is not a final sigma(38)-dependent
promoter, it is activated by the global regulator integration host factor (IHF)
in the stationary phase of growth. Gel retardation assays have demonstrated that
both CRP and IHF simultaneously bind to the Pg upstream region. DNase I
footprint experiments showed that cAMP-CRP and IHF binding sites are centered at
-61.5 and -103, respectively, with respect to the transcription start site +1 of
the Pg promoter.

PMID: 11477101 [PubMed - indexed for MEDLINE]

78: Brief Bioinform. 2000 Nov;1(4):357-71. 

Comparative analysis of regulatory patterns in bacterial genomes.

Gelfand MS, Novichkov PS, Novichkova ES, Mironov AA.

State Scientific Center, GosNIIGenetika, Moscow, Russia. misha@imb.im.ac.ru

Recognition of transcription regulatory sites in bacterial genomes is a
notoriously difficult problem.There are no algorithms capable of making reliable
predictions even for well-studied sites such as the CRP (cyclic AMP receptor
protein) box. However, availability of complete bacterial genomes makes it
possible to make reliable predictions with bad rules.This comparative approach
is based on the assumption that sets of co-regulated genes are conserved in
related bacteria.Thus true sites occur upstream of orthologous genes, whereas
false candidates are scattered at random. This means not only that knowledge
about regulation in well-studied genomes can be transferred to newly sequenced
ones, but also that new members of regulons can be found.This paper reviews
several recent studies. In particular, a detailed analysis of catabolite
repression in gamma-purple bacteria is presented.

Publication Types:
    Review
    Review, Tutorial

PMID: 11465053 [PubMed - indexed for MEDLINE]

79: Res Microbiol. 2001 Jun;152(5):469-79. 

Regulation of microcin C51 operon expression: the role of global regulators of
transcription.

Fomenko D, Veselovskii A, Khmel I.

Institute of Molecular Genetics, Russian Academy of Sciences, Moscow.

Expression of the microcin C51 operon in Escherichia coli cells is regulated as
a function of the phase of growth; it is stimulated during the decelerating
phase of growth. Using single-copy P(mcc)-lac transcriptional fusion (the
promoter region of the microcin C51 operon fused to a promoterless lac operon in
lambda phage), we showed that transcription from the microcin operon promoter is
dependent on sigma(s) (RpoS) factor. However, some level of P(mcc)-lac
expression is possible in rpoS null mutants, indicating that another sigma
factor might be involved in transcription of the microcin C51 operon.
Overproduction of sigma70 decreased Pmcc-directed transcription, presumably as a
result of competition of sigma factors for the limited amount of core RNA
polymerase. The cyclic AMP-CRP complex was shown to stimulate transcription from
Pmcc: the absence of CRP or cAMP in crp or cya mutant cells strongly decreased
the level of P(mcc)-lac expression. The production of C51 microcin decreased or
was absent in rpoS, crp and cya mutant cells. Leucine-responsive protein Lrp and
histone-like protein H-NS repressed P(mcc)-lac expression in the exponential and
decelerating phases of growth. In studies of P(mcc)-lac expression in double
mutant cells, we showed that proteins CRP, Lrp and H-NS acted in rpoS-dependent
and rpoS-independent ways in transcription of the microcin C51 operon. Mutation
hns(-) resulted in an increase in P(mcc)-lac expression in crp, rpoS and lrp
mutant cells, as in wild-type cells.

PMID: 11446515 [PubMed - indexed for MEDLINE]

80: J Mol Microbiol Biotechnol. 2001 Jul;3(3):471-81. 

The early stages of filamentous phage phiLf infection require the host
transcription factor, Clp.

Lee TC, Chen ST, Lee MC, Chang CM, Chen CH, Weng SF, Tseng YH.

Institute of Molecular Biology, National Chung Hsing University, Taiwan,
Republic of China.

Xanthomonas campestris pv. campestris produces great amounts of an
exopolysaccharide (EPS), xanthan gum. Eight eps loci involved in biosynthesis of
the EPS were previously located in the chromosome map of strain Xc17. In this
study, the eps8 region was cloned, sequenced and found to contain a crp
homologue whose deduced amino acid sequence possesses similarity to that of the
cyclic AMP receptor protein of bacteria, with the highest identity (97%) being
shared with the X. campestris pv. campestris B-1459 clp gene previously shown to
be involved in pathogenicity and regulation of the production of xanthan,
extracellular enzymes, and pigment (de Crecy-Lagard V., Glaser P., Lejeune P.,
Sismeiro O., Barber C.E., Daniels M.J., and Danchin A., J. Bacteriol.
172:5877-5883, 1990). Based on sequence identity, pleiotropic effects of the
mutation, the ability to complement an Escherichia coli cya crp mutant, and
Southern hybridization detecting a single copy in the chromosome, we propose
this eps8 gene to be the Xc17 clp. In addition to the previously reported
properties, a clp mutant (AU56E) cannot be plaqued with filamentous phage phiLf,
although it retains the capability to support phiLf DNA replication and release
authentic phage particles upon electroporation of the RF DNA. Infective center
assays demonstrated that the frequency of infection is 460- to 7,500-fold lower
in AU56E compared to that in the wild-type Xc17. Electron microscopy, which
showed no surface appendages other than the monotrichous flagellum, confirmed
that AU56E drastically diminishes in the efficiency of phage adsorption. These
results suggest Clp to be regulating the biosynthesis of the primary receptor,
most likely a type IV pilus. Upstream to clp is a homologue of the E. coli speD
gene required for spermidine synthesis. Mutation of the clp flanking regions and
transcriptional analyses suggest clp to be monocistronic and the only gene
contained at the eps8 locus.

PMID: 11361081 [PubMed - indexed for MEDLINE]

81: Biochim Biophys Acta. 2001 May 5;1547(1):1-17. 

Allosteric regulation of the cAMP receptor protein.

Harman JG.

Department of Chemistry and Biochemistry, Texas Tech University, Lubbock, TX
79409, USA. u4jgh@ttacs.ttu.edu

The cyclic AMP receptor protein (CRP) of Escherichia coli is a dimer made up of
identical subunits. Each CRP subunit contains a cyclic nucleotide binding pocket
and the CRP dimer exhibits negative cooperativity in binding cAMP. In solutions
containing cAMP, CRP undergoes sequential conformation changes from the inactive
apo-form through the active CRP:(cAMP)(1) complex to the less active
CRP:(cAMP)(2) complex depending on the cAMP concentration. Apo-CRP binds DNA
with low affinity and no apparent sequence specificity. The CRP:(cAMP)(1)
complex exhibits high affinity, sequence-specific DNA binding and interacts with
RNA polymerase, whether free in solution or complexed with DNA. The results of
genetic, biochemical and biophysical studies have helped to uncover many of the
details of cAMP-mediated allosteric control over CRP conformation and activity
as a transcription factor. These studies indicate that cAMP binding produces
only small, but significant, changes in CRP structure; changes that include
subunit realignment and concerted motion of the secondary structure elements
within the C-terminal DNA binding domain of each subunit. These adjustments
promote CRP surface-patch interaction with RNA polymerase and protrusion of the
F-helix to promote CRP site-specific interaction with DNA. Interactions between
CRP and RNA polymerase at CRP-dependent promoters produce active ternary
transcription complexes.

Publication Types:
    Review
    Review, Tutorial

PMID: 11343786 [PubMed - indexed for MEDLINE]

82: J Biol Chem. 2001 Jul 13;276(28):25871-5. Epub 2001 May 4. 

Heat shock RNA polymerase (E sigma(32)) is involved in the transcription of mlc
and crucial for induction of the Mlc regulon by glucose in Escherichia coli.

Shin D, Lim S, Seok YJ, Ryu S.

Research Center for New Bio-Materials in Agriculture, Department of Food Science
and Technology and School of Agricultural Biotechnology, Seoul National
University, Suwon 441-744, Korea.

Mlc is a global regulator of carbohydrate metabolism. Recent studies have
revealed that Mlc is depressed by protein-protein interaction with enzyme
IICB(Glc), a glucose-specific permease, which is encoded by ptsG. The mlc gene
has been previously known to be transcribed by two promoters, P1(+1) and
P2(+13), and have a binding site of its own gene product at +16. However, the
mechanism of transcriptional regulation of the gene has not yet been
established. In vitro transcription assays of the mlc gene showed that P2
promoter could be recognized by RNA polymerase containing the heat shock sigma
factor final sigma(32) (E sigma(32)) as well as E sigma(70), while P1 promoter
is only recognized by E sigma(70). The cyclic AMP receptor protein and cyclic
AMP complex (CRP.cAMP) increased expression from P2 but showed negative effect
on transcription from P1 by E sigma(70), although it had little effect on
transcription from P2 by E sigma(32) in vitro. Purified Mlc repressed
transcription from both promoters, but with different degrees of inhibition. In
vivo transcription assays using wild type and mlc strains indicated that the
level of mlc expression was modulated less than 2-fold by glucose in the medium
with concerted action of CRP.cAMP and Mlc. A dramatic increase in mlc expression
was observed upon heat shock or in cells overexpressing final sigma(32),
confirming that E sigma(32) is involved in the expression of mlc. Induction of
ptsG P1 and pts P0 transcription by glucose was also dependent on E sigma(32).
These results indicate that E sigma(32) plays an important role in balancing the
relative concentration of Mlc and EIICB(Glc) in response to availability of
glucose in order to maintain inducibility of the Mlc regulon at high growth
temperature.

PMID: 11340070 [PubMed - indexed for MEDLINE]

83: J Biol Chem. 2001 May 25;276(21):17878-86. Epub 2001 Feb 23. 

CRP modulates fis transcription by alternate formation of activating and
repressing nucleoprotein complexes.

Nasser W, Schneider R, Travers A, Muskhelishvili G.

Institut fur Genetik und Mikrobiologie, Ludwig-Maximilians-Univesitaet,
Maria-Ward-Strasse 1a, 80638 Munchen, Germany.

The DNA architectural proteins FIS and CRP are global regulators of
transcription in Escherichia coli involved in the adjustment of cellular
metabolism to varying growth conditions. We have previously demonstrated that
FIS modulates the expression of the crp gene by functioning as its
transcriptional repressor. Here we show that in turn, CRP is required to
maintain the growth phase pattern of fis expression. We demonstrate the
existence of a divergent promoter in the fis regulatory region, which reduces
transcription of the fis promoter. In the absence of FIS, CRP activates fis
transcription, thereby displacing the polymerase from the divergent promoter,
whereas together FIS and CRP synergistically repress fis gene expression. These
results provide evidence for a direct cross-talk between global regulators of
cellular transcription during the growth phase. This cross-talk is manifested in
alternate formation of functional nucleoprotein complexes exerting either
activating or repressing effects on transcription.

PMID: 11279109 [PubMed - indexed for MEDLINE]

84: Biosci Biotechnol Biochem. 2001 Jan;65(1):213-7. 

Effects of the Escherichia coli sfsA gene on mal genes expression and a DNA
binding activity of SfsA.

Takeda K, Akimoto C, Kawamukai M.

Department of Life Science and Biotechnology, Shimane University, Matsue, Japan.

The sfsA gene was identified as one of the sfs genes the over-expression of
which stimulates maltose fermentation of the Mal- Escherichia coli strain MK2001
(crp*1, cya:Km(r)). Expression from the malPQ promoter, which was measured using
a chromosomally integrated malPp-lacZ fusion, was induced by over-expressing the
sfsA gene in the crp*1, cya:Km(r) strain. The level of the MalE protein was
increased in crp*1, cya:Km(r) cells over-producing SfsA. The SfsA protein was
purified to homogeneity and tested for DNA binding activity. The purified SfsA
protein binds to DNA non-specifically. All these results may suggest that SfsA
functions as a DNA binding protein to induce the mal genes in coordination with
CRP*1.

PMID: 11272834 [PubMed - indexed for MEDLINE]

85: Mol Microbiol. 2001 Mar;39(5):1285-98. 

A novel mechanism controls anaerobic and catabolite regulation of the
Escherichia coli tdc operon.

Sawers G.

Department of Molecular Microbiology, John Innes Centre, Norwich NR4 7UH, UK.
gary.sawers@bbsrc.ac.uk

The tdc operon is subject to CRP-controlled catabolite repression. Expression of
the operon is also induced anaerobically, although this regulation does not rely
on direct control by either FNR or ArcA. Recently, the anaerobic expression of
the tdc operon was found to be fortuitously induced in the presence of glucose
by a heterologous gene isolated from the Gram-positive anaerobe Clostridium
butyricum. The gene, termed tcbC, encoded a histone-like protein of 14.5 kDa.
Using tdc-lacZ fusions, it was shown that TcbC did not activate tdc expression
by functionally replacing any of the operon regulators. In vitro transcription
analyses with RNA polymerase and CRP revealed that faithful CRP-dependent
transcription initiation occurred only on supercoiled templates. No specific,
CRP-dependent transcription initiation was observed on relaxed or linear DNA
templates. Surprisingly, purified His-tagged TcbC activated transcription from a
relaxed, circular template, but not from supercoiled or linear templates.
Examination of the CRP binding site of the tdc promoter revealed that it was
located 43.5 bp upstream of the transcription initiation site. Repositioning of
the CRP site at -41.5 bp abolished activation by the TcbC protein and allowed
CRP-dependent transcription to occur on linear, relaxed and supercoiled
templates. TcbC bound DNA non-specifically; however, in topoisomerase I
relaxation assays, it was demonstrated that TcbC imposed torsional constraints
on negatively supercoiled DNA, which influenced the ability of the enzyme to
relax the topoisomers. Taken together, these results strongly suggest that TcbC
activates transcription of tdc by altering the local topological status of the
tdc promoter and that, in the wild-type tdc promoter, the CRP binding site is
misaligned to allow transcription to occur only under optimal conditions.
Indeed, in vivo transcription analyses revealed that repositioning of the CRP
binding site to -41.5 bp resulted in high-level, CRP-dependent transcription,
even under catabolite-repressing conditions, and that transcription was no
longer influenced by TcbC. Remarkably, however, anaerobic regulation of the
mutant promoter was retained. This indicates that the other tdc regulators, TdcA
and TdcR, govern anaerobic transcription activation by CRP.

PMID: 11251844 [PubMed - indexed for MEDLINE]

86: Microbiology. 2001 Mar;147(Pt 3):709-15. 

Escherichia coli acid resistance: cAMP receptor protein and a 20 bp cis-acting
sequence control pH and stationary phase expression of the gadA and gadBC
glutamate decarboxylase genes.

Castanie-Cornet MP, Foster JW.

Department of Microbiology and Immunology, University of South Alabama College
of Medicine, Mobile, AL 36688, USA.

Acid resistance is an important feature of both pathogenic and non-pathogenic
Escherichia coli. It enables survival in the acidic regions of mammalian
gastrointestinal tracts and is largely responsible for the small number of
bacteria required for infection/colonization. Three systems of acid resistance
have been identified, the most efficient of which requires glutamic acid during
pH 2 acid challenge. Three proteins associated with glutamate-dependent acid
resistance have been identified. They are glutamate decarboxylase (encompassing
two isozymes encoded by gadA and gadB) and a putative glutamate:gamma-amino
butyric acid antiporter (encoded by gadC). The results confirm that the GadA and
GadB proteins increase in response to stationary phase and low environmental pH.
The levels of these proteins correspond to concomitant changes in gadA and gadBC
mRNA levels. Fusions between lacZ and the gadA and gadBC operons indicate that
this control occurs at the transcriptional level. Western blot, Northern blot
and fusion analyses reveal that regulation of these genes is complex. Expression
in rich media is restricted to stationary phase. However, in minimal media, acid
pH alone can trigger induction in exponential or stationary phase cells. Despite
this differential control, there is only one transcriptional start site for each
gene. Expression in rich media is largely dependent on the alternate sigma
factor sigma(S) and is repressed by the cAMP receptor protein (CRP). In
contrast, sigma(S) has only a minor role in gad transcription in cells grown in
minimal media. Deletions of the regulatory region upstream of gadA provided
evidence that a 20 bp conserved region located 50 bp from the transcriptional
start of both operons is required for expression.

PMID: 11238978 [PubMed - indexed for MEDLINE]

87: Biomol Eng. 2001 Mar;17(3):113-7. 

DNA architecture and transcriptional regulation of the Escherichia coli
penicillin amidase (pac) gene.

Stojcevic N, Moric I, Begovic J, Radoja S, Konstantinovic M.

Institute of Molecular Genetics and Genetic Engineering, Vojvode Stepe 444a,
P.O. Box 446, 11000, Belgrade, Yugoslavia.

The transcriptional regulation of Escherichia coli ATCC11105 penicillin amidase
(pac) gene was studied by modifying DNA sequences responsible for promoter
activation by cyclic AMP receptor protein (CRP). The nucleotide sequence of the
5'-flanking region of the pac gene contains putative tandem CRP binding sites
positioned at -69/-70 and at -111/-112 with respect to the transcriptional start
site. Our results obtained with either point mutations or insertion or deletion
mutants (each of which rotated the helix structure at the CRP binding site
one-half turn) showed significant decrease of penicillin amidase (PA) activity,
suggesting the CRP as a major activator. In this study, the evidence for the
importance of spacing between tandem binding sites for CRP as well as for their
location related to the promoter core sequence has been provided. Involvement of
integration host factor (IHF) as an additional regulatory protein in the pac
gene transcription regulation was also analyzed. It is shown that activation of
the pac gene transcription is elevated by IHF.

PMID: 11222985 [PubMed - indexed for MEDLINE]

88: J Bacteriol. 2001 Mar;183(5):1755-64. 

Growth-phase-dependent expression of the cyclopeptide antibiotic microcin J25.

Chiuchiolo MJ, Delgado MA, Farias RN, Salomon RA.

Departamento de Bioquimica de la Nutricion, Instituto Superior de
Investigaciones Biologicas, 4000 San Miguel de Tucuman, Tucuman, Argentina.

Microcin J25 is a 2,107-Da, plasmid-encoded, cyclopeptide antibiotic produced by
Escherichia coli. We have isolated lacZ fusions to mcjA (encoding the
58-amino-acid microcin precursor) and mcjB and mcjC (which are required for
microcin maturation), and the regulation of these fusions was used to identify
factors that control the expression of these genes. The mcjA gene was found to
be dramatically induced as cells entered the stationary phase. Expression of
mcjA could be induced by resuspending uninduced exponential-phase cells in spent
supernatant obtained from an early-stationary-phase culture. Induction of mcjA
expression was not dependent on high cell density, pH changes, anaerobiosis, or
the buildup of some inducer. A starvation for carbon and inorganic phosphate
induced mcjA expression, while under nitrogen limitation there was no induction
at all. These results taken together suggest that stationary-phase induction of
mcjA is triggered by nutrient depletion. The mcjB and mcjC genes were also
regulated by the growth phase of the culture, but in contrast to mcjA, they
showed substantial expression already during exponential growth. Induction of
the microcin genes was demonstrated to be independent of RpoS, the cyclic
AMP-Crp complex, OmpR, and H-NS. Instead, we found that the
growth-phase-dependent expression of mcjA, mcjB, and mcjC may be explained by
the concerted action of the positively acting transition state regulators ppGpp,
Lrp, and integration host factor. Measurements of microcin J25 production by
strains defective in these global regulators showed a good correlation with the
reduced expression of the fusions in such mutant backgrounds.

PMID: 11160108 [PubMed - indexed for MEDLINE]

89: Can J Microbiol. 2000 Dec;46(12):1159-65. 

Identification of DNA sequences that regulate the expression of the Enterobacter
cloacae UW4 1-aminocyclopropane-1-carboxylic acid deaminase gene.

Grichko VP, Glick BR.

Department of Biology, University of Waterloo, ON, Canada.

Analysis of the DNA sequence upstream of the previously isolated Enterobacter
cloacae UW4 ACC deaminase gene (Shah et al. 1998) suggests that this segment
contains several features that are thought to be involved in the transcriptional
regulation of this gene. These features include half of a CRP (cAMP receptor
protein) binding site, an FNR (fumarate-nitrate reduction) regulatory protein
binding site, an LRP (leucine responsive regulatory protein) binding site, and
an LRP-like protein coding region. ACC deaminase activity was measured following
growth of either various Escherichia coli strains carrying a plasmid that
contained the Enterobacter cloacae UW4 ACC deaminase gene, or of Enterobacter
cloacae UW4. Variables that were compared include aerobic versus anaerobic
conditions, the presence and absence of ACC in the growth medium, addition of
leucine to the medium, and bacterial strains that did or did not contain either
lrp or fnr genes. The data reported are consistent with the involvement of most,
if not all, of the above mentioned potential regulatory regions in the
expression of ACC deaminase.

PMID: 11142408 [PubMed - indexed for MEDLINE]

90: Nucleic Acids Res. 2001 Jan 15;29(2):380-6. 

Conserved regulatory elements of the promoter sequence of the gene rpoH of
enteric bacteria.

Ramirez-Santos J, Collado-Vides J, Garcia-Varela M, Gomez-Eichelmann MC.

Departamento de Biologia Molecular, Instituto de Investigaciones Biomedicas,
Universidad Nacional Autonoma de Mexico, PO Box 70-228, 04510 Mexico, D. F.,
Mexico.

The rpoH regulatory region of different members of the enteric bacteria family
was sequenced or downloaded from GenBank and compared. In addition, the
transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus
mirabilis, two distant members of this family, were determined. Sequences
similar to the sigma(70) promoters P1, P4 and P5, to the sigma(E) promoter P3
and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box
CytR present in Escherichia coli K12, were identified in sequences of closely
related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar
Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella
pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH
regulatory region has a distal P1-like sigma(70) promoter and two proximal
promoters: a heat-induced sigma(E)-like promoter and a sigma(70) promoter.
Sequences similar to the regulatory boxes were not identified in these bacteria.
This study suggests that the general pattern of transcription of the rpoH gene
in enteric bacteria includes a distal sigma(70) promoter, >200 nt upstream of
the initiation codon, and two proximal promoters: a heat-induced sigma(E)-like
promoter and a sigma(70) promoter. A second proximal sigma(70) promoter under
catabolite-regulation is probably present only in bacteria closely related to
E.coli.

PMID: 11139607 [PubMed - indexed for MEDLINE]

91: Mol Microbiol. 2000 Nov;38(4):673-83. 

Transcriptional regulation of transport and utilization systems for hexuronides,
hexuronates and hexonates in gamma purple bacteria.

Rodionov DA, Mironov AA, Rakhmaninova AB, Gelfand MS.

State Scientific Center GosNIIGenetika, Moscow, 113545, Russia.
rodionov@genetika.ru

The comparative approach is a powerful tool for the analysis of gene regulation
in bacterial genomes. It can be applied to the analysis of regulons that have
been studied experimentally as well as that of regulons for which no known
regulatory sites are available. It is assumed that the set of co-regulated genes
and the regulatory signal itself are conserved in related genomes. Here, we use
genomic comparisons to study the regulation of transport and utilization systems
for sugar acids in gamma purple bacteria Escherichia coli, Salmonella typhi,
Klebsiella pneumoniae, Yersinia pestis, Erwinia chrysanthemi, Haemophilus
influenzae and Vibrio cholerae. The variability of the operon structure and the
location of the operator sites for the main transcription factors are
demonstrated. The common metabolic map is combined with known and predicted
regulatory interactions. It includes all known and predicted members of the
GntR, UxuR/ExuR, KdgR, UidR and IdnR regulons. Moreover, most members of these
regulons seem to be under catabolite repression mediated by CRP. The candidate
UxuR/ExuR signal is proposed, the KdgR consensus is extended, and new operators
for all transcription factors are identified in all studied genomes. Two new
members of the KdgR regulon, a hypothetical ATP-dependent transport system
OgtABCD and YjgK protein with unknown function, are detected. The former is
likely to be the transport system for the products of pectin degradation,
oligogalacturonides.

PMID: 11115104 [PubMed - indexed for MEDLINE]

92: Microbiology. 2000 Dec;146 Pt 12:3183-94. 

Genomic survey of cAMP and cGMP signalling components in the cyanobacterium
Synechocystis PCC 6803.

Ochoa de Alda JA, Houmard J.

Dynamique des Membranes Vegetales, Complexes Proteines-Pigments, CNRS UMR 8543,
Ecole Normale Superieure, 46 rue d'Ulm 75230 Paris Cedex 05, France.

Cyanobacteria modulate intracellular levels of cAMP and cGMP in response to
environmental conditions (light, nutrients and pH). In an attempt to identify
components of the cAMP and cGMP signalling pathways in Synechocystis PCC 6803,
the authors screened its complete genome sequence by using bioinformatic tools
and data from sequence-function studies performed on both eukaryotic and
prokaryotic cAMP/cGMP-dependent proteins. Sll1624 and Slr2100 were tentatively
assigned as being two putative cyclic nucleotide phosphodiesterases. Five
proteins were identified as having all the determinants required to be cyclic
nucleotide receptors, two of them being probably more specific for cGMP (an
element of two-component regulatory systems - Slr2104 - and a putative
cyclic-nucleotide-gated cation channel - Slr1575), the three others being
probably more specific for cAMP: (i) a protein of unidentified function
(Slr0842); (ii) a putative cyclic-nucleotide-modulated permease (Slr0593),
previously annotated as a kinase A regulatory subunit; and (iii) a putative
transcription factor (CRP-SYN: =Sll1371), which possesses cAMP- and DNA-binding
determinants homologous to those of the cAMP receptor protein of Escherichia
coli (CRP-EC:). This homology, together with the presence in Synechocystis of
CRP-EC:-like binding sites upstream of crp, cya1, slr1575, and several genes
encoding enzymes involved in transport and metabolism, strongly suggests that
CRP-SYN: is a global regulator.

PMID: 11101676 [PubMed - indexed for MEDLINE]

93: Microbiology. 2000 Dec;146 Pt 12:3157-70. 

YeiL, the third member of the CRP-FNR family in Escherichia coli.

Anjum MF, Green J, Guest JR.

The Krebs Institute for Biomolecular Research, Department of Molecular Biology
and Biotechnology, University of Sheffield, Western Bank, Sheffield S10 2TN, UK.

The yeiL open reading frame located at 48.5 min (2254 kb) in the nfo-fruA region
of the Escherichia coli chromosome was predicted to encode a CRP and FNR
paralogue capable of forming inter- or intra-molecular disulphide bonds and
incorporating one iron-sulphur centre per 25 kDa subunit. Purified MBP-YeiL (a
maltose-binding-protein-YeiL fusion protein) was a high-molecular-mass oligomer
or aggregate which released unstable monomers (68 kDa) under reducing
conditions. The MBP-YeiL protein contained substoichiometric amounts of iron and
acid-labile sulphide, and an average of one disulphide bond per monomer. The
iron and sulphide contents increased consistent with the acquisition of one
[4Fe-4S] cluster per monomer after anaerobic NifS-catalysed reconstitution. By
analogy with FNR and FLP (the FNR-like protein of Lactobacillus casei) it was
suggested that the transcription-regulatory activity of YeiL might be modulated
by a sensory iron-sulphur cluster and/or by reversible disulphide bond
formation. A yeiL-lacZ transcriptional fusion showed that aerobic yeiL
expression increases at least sixfold during stationary phase, requires RpoS,
and is positively autoregulated by YeiL, positively activated by Lrp (and IHF in
the absence of FNR) and negatively regulated by FNR. A regulatory link between
the synthesis of YeiK (a potential nucleoside hydrolase) and YeiL was inferred
by showing that the yeiK and yeiL genes are divergently transcribed from
overlapping promoters. A 10-15% deficiency in aerobic growth yield and an
enhanced loss of viability under nitrogen starvation conditions were detected
with a yeiL::kan(R) mutant, suggesting that YeiL might function as a
post-exponential-phase nitrogen-starvation regulator.

PMID: 11101674 [PubMed - indexed for MEDLINE]

94: J Theor Biol. 2000 Dec 7;207(3):349-59. 

Regulation of competence development in Haemophilus influenzae.

Macfadyen LP.

Department of Zoology, University of British Columbia, Vancouver, British
Columbia, V6T 1Z4, Canada. macfad@uwc.net

Development of competence for DNA uptake by the bacterium Haemophilus influenzae
is tightly regulated, and expression of the cell's complement of competence
genes is absolutely dependent on the cAMP-CRP complex. A second regulator of
competence may maximize competence under starvation conditions. Several
investigators have recently identified a consensus sequence (competence
regulatory element, CRE) in the promoter regions of some competence genes and
have proposed that this may be a binding site for Sxy (TfoX), a putative
positive regulator of competence. However, a scoring method that reliably ranks
candidate binding sites according to affinity for the cognate binding protein
predicts that the cAMP-CRP complex will bind CRE sequences with high affinity.
Moreover, the predicted Sxy protein lacks recognizable DNA-binding motifs and
has not been shown to bind DNA. No other consensus sequences (putative binding
sites) were identified in the promoter regions of competence genes. These
observations suggest that the proposed competence-specific regulatory elements
are in fact CRP-binding sites, and highlight the central role of cAMP-an
established bacterial mediator of the response to nutritional stress-in
competence regulation. Minor sequence elements uniquely conserved in the set of
CRE sequences are predicted to reduce CRP affinity, and a model is suggested in
which a secondary regulator of competence genes may interact with CRP under
certain conditions to stabilize the initiation complex. Copyright 2000 Academic
Press.

PMID: 11082305 [PubMed - indexed for MEDLINE]

95: J Bacteriol. 2000 Dec;182(23):6774-82. 

Interdependence of activation at rhaSR by cyclic AMP receptor protein, the RNA
polymerase alpha subunit C-terminal domain, and rhaR.

Holcroft CC, Egan SM.

Department of Molecular Biosciences, University of Kansas, Lawrence, Kansas
66045, USA.

The Escherichia coli rhaSR operon encodes two AraC family transcription
activators, RhaS and RhaR, and is activated by RhaR in the presence of
L-rhamnose. beta-Galactosidase assays of various rhaS-lacZ promoter fusions
combined with mobility shift assays indicated that a cyclic AMP receptor protein
(CRP) site located at -111.5 is also required for full activation of rhaSR
expression. To address the mechanisms of activation by CRP and the RNA
polymerase alpha-subunit C-terminal domain (alpha-CTD) at rhaSR, we tested the
effects of alanine substitutions in CRP activating regions 1 and 2,
overexpression of a truncated version of alpha (alpha-Delta235), and alanine
substitutions throughout alpha-CTD. We found that DNA-contacting residues in
alpha-CTD are required for full activation, and for simplicity, we discuss
alpha-CTD as a third activator of rhaSR. CRP and RhaR could each partially
activate transcription in the absence of the other two activators, and alpha-CTD
was not capable of activation alone. In the case of CRP, this suggests that this
activation involves neither an alpha-CTD interaction nor cooperative binding
with RhaR, while in the case of RhaR, this suggests the likelihood of direct
interactions with core RNA polymerase. We also found that CRP, RhaR, and
alpha-CTD each have synergistic effects on activation by the others, suggesting
direct or indirect interactions among all three. We have some evidence that the
alpha-CTD-CRP and alpha-CTD-RhaR interactions might be direct. The magnitude of
the synergistic effects was usually greater with just two activators than with
all three, suggesting possible redundancies in the mechanisms of activation by
CRP, alpha-CTD, and RhaR.

PMID: 11073923 [PubMed - indexed for MEDLINE]

96: J Bacteriol. 2000 Nov;182(22):6347-57. 

Silencing and activation of ClyA cytotoxin expression in Escherichia coli.

Westermark M, Oscarsson J, Mizunoe Y, Urbonaviciene J, Uhlin BE.

Department of Microbiology, Umea University, S-90187 Umea, Sweden.

Cytolysin A (ClyA) is a pore-forming cytotoxic protein encoded by the clyA gene
of Escherichia coli K-12. Genetic analysis suggested that clyA is silenced by
the nucleoid protein H-NS. Purified H-NS protein showed preferential binding to
clyA sequences in the promoter region, as evidenced by DNase I footprinting and
gel mobility shift assays. Transcriptional derepression and activation of a
chromosomal clyA::luxAB operon fusion were seen under conditions of H-NS
deficiency and SlyA overproduction, respectively. In H-NS-deficient bacteria
neither the absence nor the overproduction of SlyA affected the derepressed ClyA
expression any further. Therefore, we suggest that overproduction of SlyA in
hns(+) E. coli derepresses clyA transcription by counteracting H-NS. The cyclic
AMP receptor protein (CRP) was required for ClyA expression, and it interacted
with a predicted, albeit suboptimal, CRP binding site in the clyA upstream
region. Site-specific alterations of the CRP binding site to match the consensus
resulted in substantially higher levels of ClyA expression, while alterations
that were predicted to reduce CRP binding reduced ClyA expression. During
anaerobic growth the fumarate and nitrate reduction regulator (FNR) was
important for ClyA expression, and the clyA gene could be activated by
overexpression of FNR. A major clyA transcript having its 5' end (+1) located 72
bp upstream of the translational start codon and 61 bp downstream of the CRP-FNR
binding site was detected in the absence of H-NS. The clyA promoter was
characterized as a class I promoter that could be transcriptionally activated by
CRP and/or FNR. According to DNA bending analyses, the clyA promoter region has
high intrinsic curvature. We suggest that it represents a regulatory region
which is particularly susceptible to H-NS silencing, and its features are
discussed in relation to regulation of other silenced operons.

PMID: 11053378 [PubMed - indexed for MEDLINE]

97: FEMS Microbiol Lett. 2000 Oct 15;191(2):227-34. 

Regulation of anaerobic arginine catabolism in Bacillus licheniformis by a
protein of the Crp/Fnr family.

Maghnouj A, Abu-Bakr AA, Baumberg S, Stalon V, Vander Wauven C.

Laboratoire de Microbiologie, Universite Libre de Bruxelles, Brussels, Belgium.

Arginine anaerobic catabolism occurs in Bacillus licheniformis through the
arginine deiminase pathway, encoded by the gene cluster arcABDC. We report here
the involvement of a new protein, ArcR, in the regulation of the pathway. ArcR
is a protein of the Crp/Fnr family encoded by a gene located 109 bp downstream
from arcC. It binds to a palindromic sequence, very similar to an Escherichia
coli Crp binding site, located upstream from arcA. Residues in the C-terminal
domain of Crp that form the DNA binding motif, in particular residues Arg-180
and Glu-181 that make specific bonds with DNA, are conserved in ArcR, suggesting
that the complexes formed with DNA by Crp and ArcR are similar. Moreover, the
pattern of DNase I hypersensitivity sites induced by the binding of ArcR
suggests that ArcR bends the DNA in the same way as Crp. From the absence of
anaerobic induction following inactivation of arcR and from the existence of a
binding site upstream of the arcA transcription start point, it can be inferred
that ArcR is an activator of the arginine deiminase pathway.

PMID: 11024268 [PubMed - indexed for MEDLINE]

98: Nat Struct Biol. 2000 Oct;7(10):822-4. 

CooA, CAP and allostery.

Chan MK.

Publication Types:
    News

PMID: 11017182 [PubMed - indexed for MEDLINE]

99: J Bacteriol. 2000 Oct;182(19):5596-9. 

Dual transcriptional regulation of the Escherichia coli
phosphate-starvation-inducible psiE gene of the phosphate regulon by PhoB and
the cyclic AMP (cAMP)-cAMP receptor protein complex.

Kim SK, Kimura S, Shinagawa H, Nakata A, Lee KS, Wanner BL, Makino K.

Research Center for Biomedicinal Resources (Bio-Med RRC), Paichai University,
Taejon 302-735, Korea.

We have shown that the Escherichia coli phosphate-starvation-inducible psiE gene
is regulated by both phosphate and the carbon source by using both lacZ and
chloramphenicol acetyltransferase gene (cat) fusions. Yet, under all conditions
tested, a single transcriptional start site lying 7 bp downstream of a predicted
-10 region was revealed by primer extension analysis. DNase I footprinting
showed that the PhoB transcriptional-activator protein protects two predicted
pho boxes lying upstream of and near the -35 promoter region. Similar analysis
showed that the cyclic AMP (cAMP)-cAMP receptor protein (cAMP-CRP) complex binds
a region that overlaps with the downstream pho box. These results, together with
measurements of the in vivo psiE promoter activity under various conditions,
show that expression of the psiE gene is under direct positive and negative
control by PhoB and cAMP-CRP, respectively.

PMID: 10986267 [PubMed - indexed for MEDLINE]

100: Cell. 2000 Aug 18;102(4):475-85. 

Nucleoid proteins stimulate stringently controlled bacterial promoters: a link
between the cAMP-CRP and the (p)ppGpp regulons in Escherichia coli.

Johansson J, Balsalobre C, Wang SY, Urbonaviciene J, Jin DJ, Sonden B, Uhlin BE.

Department of Microbiology, Umea University, Sweden.

We report that the H-NS nucleoid protein plays a positive role in the expression
of stringently regulated genes in Escherichia coli. Bacteria lacking both H-NS
and the paralog StpA show reduced growth rate. Colonies displaying an increased
growth rate were isolated, and mapping of a suppressor mutation revealed a base
pair substitution in the spoT gene. The spoT(A404E) mutant showed low ppGpp
synthesizing ability. The crp gene, which encodes the global regulator CRP, was
subject to negative stringent regulation. The stable RNA/protein ratio in an
hns, stpA strain was decreased, whereas it was restored in the suppressor
strain. Our findings provide evidence of a direct link between the cAMP-CRP
modulon and the stringent response.

PMID: 10966109 [PubMed - indexed for MEDLINE]

101: J Bacteriol. 2000 Sep;182(17):4959-69. 

Genetic evidence that transcription activation by RhaS involves specific amino
acid contacts with sigma 70.

Bhende PM, Egan SM.

Department of Molecular Biosciences, University of Kansas, Lawrence, Kansas
66045, USA.

RhaS activates transcription of the Escherichia coli rhaBAD and rhaT operons in
response to L-rhamnose and is a member of the AraC/XylS family of transcription
activators. We wished to determine whether sigma(70) might be an activation
target for RhaS. We found that sigma(70) K593 and R599 appear to be important
for RhaS activation at both rhaBAD and rhaT, but only at truncated promoters
lacking the binding site for the second activator, CRP. To determine whether
these positively charged sigma(70) residues might contact RhaS, we constructed
alanine substitutions at negatively charged residues in the C-terminal domain of
RhaS. Substitutions at four RhaS residues, E181A, D182A, D186A, and D241A, were
defective at both truncated promoters. Finally, we assayed combinations of the
RhaS and sigma(70) substitutions and found that RhaS D241 and sigma(70) R599 met
the criteria for interacting residues at both promoters. Molecular modeling
suggests that sigma(70) R599 is located in very close proximity to RhaS D241;
hence, this work provides the first evidence for a specific residue within an
AraC/XylS family protein that may contact sigma(70). More than 50% of AraC/XylS
family members have Asp or Glu at the position of RhaS D241, suggesting that
this interaction with sigma(70) may be conserved.

PMID: 10940041 [PubMed - indexed for MEDLINE]

102: J Bacteriol. 2000 Aug;182(16):4617-24. 

Regulation of expression of the yiaKLMNOPQRS operon for carbohydrate utilization
in Escherichia coli: involvement of the main transcriptional factors.

Ibanez E, Campos E, Baldoma L, Aguilar J, Badia J.

Department of Biochemistry, School of Pharmacy, University of Barcelona, 08028
Barcelona, Spain.

The yiaKLMNOPQRS (yiaK-S) gene cluster of Escherichia coli is believed to be
involved in the utilization of a hitherto unknown carbohydrate which generates
the intermediate L-xylulose. Transcription of yiaK-S as a single message from
the unique promoter found upstream of yiaK is proven in this study. The 5' end
has been located at 60 bp upstream from the ATG. Expression of the yiaK-S operon
is controlled in the wild-type strain by a repressor encoded by yiaJ. No inducer
molecule of the yiaK-S operon has been identified among over 80 carbohydrate or
derivative compounds tested, the system being expressed only in a mutant strain
lacking the YiaJ repressor. The lacZ transcriptional fusions in the genetic
background of the mutant strain revealed that yiaK-S is modulated by the
integration host factor and by the cyclic AMP (cAMP)-cAMP receptor protein (Crp)
activator complex. A twofold increase in the induction was observed during
anaerobic growth, which was independent of ArcA or Fnr. Gel mobility shift
assays showed that the YiaJ repressor binds to a promoter fragment extending
from -50 to +121. These studies also showed that the cAMP-Crp complex can bind
to two different sites. The lacZ transcriptional fusions of different fragments
of the promoter demonstrated that binding of cAMP-Crp to the Crp site 1,
centered at -106, is essential for yiaK-S expression. The 5' end of the yiaJ
gene was determined, and its promoter region was found to overlap with the
divergent yiaK-S promoter. Expression of yiaJ is autogenously regulated and
reduced by the binding of Crp-cAMP to the Crp site 1 of the yiaK-S promoter.

PMID: 10913096 [PubMed - indexed for MEDLINE]

103: J Bacteriol. 2000 Aug;182(15):4173-9. 

Regulation of acetyl coenzyme A synthetase in Escherichia coli.

Kumari S, Beatty CM, Browning DF, Busby SJ, Simel EJ, Hovel-Miner G, Wolfe AJ.

Department of Microbiology and Immunology, Stritch School of Medicine, Loyola
University Chicago, Maywood, Illinois 60153, USA.

Cells of Escherichia coli growing on sugars that result in catabolite repression
or amino acids that feed into glycolysis undergo a metabolic switch associated
with the production and utilization of acetate. As they divide exponentially,
these cells excrete acetate via the phosphotransacetylase-acetate kinase
pathway. As they begin the transition to stationary phase, they instead resorb
acetate, activate it to acetyl coenzyme A (acetyl-CoA) by means of the enzyme
acetyl-CoA synthetase (Acs) and utilize it to generate energy and biosynthetic
components via the tricarboxylic acid cycle and the glyoxylate shunt,
respectively. Here, we present evidence that this switch occurs primarily
through the induction of acs and that the timing and magnitude of this induction
depend, in part, on the direct action of the carbon regulator cyclic AMP
receptor protein (CRP) and the oxygen regulator FNR. It also depends, probably
indirectly, upon the glyoxylate shunt repressor IclR, its activator FadR, and
many enzymes involved in acetate metabolism. On the basis of these results, we
propose that cells induce acs, and thus their ability to assimilate acetate, in
response to rising cyclic AMP levels, falling oxygen partial pressure, and the
flux of carbon through acetate-associated pathways.

PMID: 10894724 [PubMed - indexed for MEDLINE]

104: J Mol Biol. 2000 Jun 2;299(2):311-24. 

Interactions between activating region 3 of the Escherichia coli cyclic AMP
receptor protein and region 4 of the RNA polymerase sigma(70) subunit:
application of suppression genetics.

Rhodius VA, Busby SJ.

School of Biosciences, The University of Birmingham, Birmingham, B15 2TT, UK.

The Escherichia coli cyclic AMP receptor protein, CRP, induces transcription at
Class II CRP-dependent promoters by making three different activatory contacts
with different surfaces of holo RNA polymerase. One contact surface of CRP,
known as Activating Region 3 (AR3), is functional in the downstream subunit of
the CRP dimer and is predicted to interact with region 4 of the RNAP sigma(70)
subunit. We have previously shown that a mutant CRP derivative that activates
transcription primarily via AR3, CRP HL159 KE101 KN52, requires the positively
charged residues K593, K597 and R599 in sigma(70) for activation. Here, we have
used the positive control substitution, EK58, to disrupt AR3-dependent
activation by CRP HL159 KE101 KN52. We then screened random mutant libraries and
an alanine scan library of sigma(70) for candidates that restore activation by
CRP HL159 KE101 KN52 EK58. We found that changes at R596 and R599 in sigma(70)
can restore activation by CRP HL159 KE101 KN52 EK58. This suggests that the
side-chains of both R596 and R599 in sigma(70) clash with K58 in CRP. Maximal
activation by CRP HL159 KE101 KN52 EK58 is achieved with the substitutions RE596
or RD596 in sigma(70). We propose that there are specific charge-charge
interactions between E596 or D596 in sigma(70) and K58 in AR3. Thus, no increase
in activation is observed in the presence of another positive control
substitution, EG58 (CRP HL159 KE101 KN52 EG58). Similarly, both sigma(70) RE596
and sigma(70) RD596 can restore activation by CRP EK58 but not CRP EG58, and
they both decrease activation by wild-type CRP. We suggest that E596 and D596 in
sigma(70) can positively interact with K58 in AR3, thereby enhancing activation,
but negatively interact with E58, thereby decreasing activation. The
substitution, KA52 in AR3 increases Class II CRP-dependent activation by
removing an inhibitory lysine residue. However, this increase is not observed in
the presence of either sigma(70) RE596 or sigma(70) RD596. We conclude that the
inhibitory side-chain, K52 in AR3, clashes with R596 in sigma(70). Finally, we
show that the sigma(70) RE596 and RD596 substitutions affect CRP-dependent
activation from Class II, but not Class I, promoters. Copyright 2000 Academic
Press.

PMID: 10860740 [PubMed - indexed for MEDLINE]

105: J Mol Biol. 2000 Jun 2;299(2):295-310. 

Transcription activation by the Escherichia coli cyclic AMP receptor protein:
determinants within activating region 3.

Rhodius VA, Busby SJ.

School of Biosciences, The University of Birmingham, Birmingham, B15 2TT, UK.

At Class II CRP-dependent promoters, the Escherichia coli cyclic AMP receptor
protein (CRP) activates transcription by making multiple interactions with RNA
polymerase (RNAP). Two discrete surfaces of CRP, known as Activating Region 1
(AR1) and Activating Region 2 (AR2), interact with the C-terminal and N-terminal
domains, respectively, of the alpha subunit of RNAP. Activating Region 3 (AR3)
is a third separate surface of CRP, which is thought to interact with a target
in the C-terminal region of the RNAP sigma(70) subunit. We have used a CRP
mutant that functions primarily via AR3, CRP HL159 KE101 KN52, as a tool to
identify residues within AR3 that are important for activation. This was
achieved by screening a random mutant library of the gene encoding CRP HL159
KE101 KN52 for positive control mutants at Class II CRP-dependent promoters, and
also by performing alanine scanning mutagenesis. Using both in vivo reporter
assays and in vitro transcription assays, we measured the effects of key
substitutions within AR3 on transcription activation in both CRP HL159 KE101
KN52 and wild-type CRP. We show that a cluster of negatively charged
surface-exposed residues at positions 53, 54, 55 and 58 is required for optimal
activation at a Class II, but not at a Class I, CRP-dependent promoter. We
conclude that these residues in AR3 of CRP form an activatory determinant for
Class II transcription activation. Abortive initiation assays were used to show
that this activatory determinant accelerates the rate of isomerisation from the
closed to open complex at a Class II CRP-dependent promoter. AR3 of CRP also
contains an inhibitory determinant: the lysine residue at position 52 of CRP is
inhibitory to maximal levels of transcription activation from Class II
promoters. We show that the negative effects of K52 are not simply due to
"masking" of the negatively charged residues at positions 53, 54, 55 and 58. Our
results suggest that, during activation by wild-type CRP, the activatory and
inhibitory determinants of AR3 balance each other. Thus, activation is
predominantly determined by AR1 and AR2. Copyright 2000 Academic Press.

PMID: 10860739 [PubMed - indexed for MEDLINE]

106: FEMS Microbiol Lett. 2000 Jun 15;187(2):115-22. 

Regulation of the divergent guaBA and xseA promoters of Escherichia coli by the
cyclic AMP receptor protein.

Hutchings MI, Drabble WT.

Division of Biochemistry and Molecular Biology, School of Biological Sciences,
University of Southampton, Biomedical Sciences Building, Bassett Crescent East,
SO16 7PX, Southampton, UK.

The gua promoter (guaP) of Escherichia coli resembles those for ribosomal RNA
(rrn) operons and lies in a close back-to-back arrangement with the promoter for
xseA (xseP). Transcription from guaP is subject to stringent control and
growth-rate-dependent regulation, and to repression by DnaA and PurR. In
addition, transcription from guaP is regulated by the cyclic AMP receptor
protein (CRP). Plasmid-borne promoter fusions to the receptor gene for
chloramphenicol acetyl transferase were used to assess the role of CRP in
controlling transcription from guaP and xseP following a downshift of cultures
from rich into minimal medium. CRP is required to activate guaBA transcription
and repress xseA transcription following downshift. Bandshift assays with a DNA
fragment carrying the divergent promoters revealed specific binding of CRP. We
propose that CRP, binding to a near-consensus site centred at -117.5, activates
transcription from guaP and obstructs transcription from the xseA promoter.

PMID: 10856643 [PubMed - indexed for MEDLINE]

107: EMBO J. 2000 Jun 15;19(12):3028-37. 

sigma factor selectivity of Escherichia coli RNA polymerase: role for CRP, IHF
and lrp transcription factors.

Colland F, Barth M, Hengge-Aronis R, Kolb A.

Institut Pasteur, Unite de Physicochimie des Macromolecules Biologiques (URA
1773 du CNRS), 75724 Paris, Cedex 15, France.

osmY is a stationary phase-induced and osmotically regulated gene in Escherichia
coli that requires the stationary phase RNA polymerase (Esigma(S)) for in vivo
expression. We show here that the major RNA polymerase, Esigma(70), also
transcribes osmY in vitro and, depending on genetic background, even in vivo.
The cAMP receptor protein (CRP) bound to cAMP, the leucine-responsive regulatory
protein (Lrp) and the integration host factor (IHF) inhibit transcription
initiation at the osmY promoter. The binding site for CRP is centred at -12.5
from the transcription start site, whereas Lrp covers the whole promoter region.
The site for IHF maps in the -90 region. By mobility shift assay, permanganate
reactivity and in vitro transcription experiments, we show that repression is
much stronger with Esigma(70) than with Esigma(S) holoenzyme. We conclude that
CRP, Lrp and IHF inhibit open complex formation more efficiently with Esigma(70)
than with Esigma(S). This different ability of the two holoenzymes to interact
productively with promoters once assembled in complex nucleoprotein structures
may be a crucial factor in generating sigma(S) selectivity in vivo.

PMID: 10856246 [PubMed - indexed for MEDLINE]

108: Genome Res. 2000 Jun;10(6):744-57. 

Conservation of DNA regulatory motifs and discovery of new motifs in microbial
genomes.

McGuire AM, Hughes JD, Church GM.

Graduate Program in Biophysics, and Department of Genetics, Lipper Center for
Computational Genetics, Harvard Medical School, Boston, MA 02115 USA.

Regulatory motifs can be found by local multiple alignment of upstream regions
from coregulated sets of genes, or regulons. We searched for regulatory motifs
using the program AlignACE together with a set of filters that helped us choose
the motifs most likely to be biologically relevant in 17 complete microbial
genomes. We searched the upstream regions of potentially coregulated genes
grouped by three methods: (1) genes that make up functional pathways; (2) genes
homologous to regulons from a well-studied species (Escherichia coli); and (3)
groups of genes derived from conserved operons. This last group is based on the
observation that genes making up homologous regulons in different species are
often assorted into coregulated operons in different combinations. This allows
partial reconstruction of regulons by looking at operon structure across several
species. Unlike other methods for predicting regulons, this method does not
depend on the availability of experimental data other than the genome sequence
and the locations of genes. New, statistically significant motifs were found in
the genome sequence of each organism using each grouping method. The most
significant new motif was found upstream of genes in the methane-metabolism
functional group in Methanobacterium thermoautotrophicum. We found that at least
27% of the known E. coli DNA-regulatory motifs are conserved in one or more
distantly related eubacteria. We also observed significant motifs that differed
from the E. coli motif in other organisms upstream of sets of genes homologous
to known E. coli regulons, including Crp, LexA, and ArcA in Bacillus subtilis;
four anaerobic regulons in Archaeoglobus fulgidus (NarL, NarP, Fnr, and ModE);
and the PhoB, PurR, RpoH, and FhlA regulons in other archaebacterial species. We
also used motif conservation to aid in finding new motifs by grouping upstream
regions from closely related bacteria, thus increasing the number of instances
of the motif in the sequence to be aligned. For example, by grouping upstream
sequences from three archaebacterial species, we found a conserved motif that
may regulate ferrous ion transport that was not found in individual genomes.
Discovery of conserved motifs becomes easier as the number of closely related
genome sequences increases.

PMID: 10854408 [PubMed - indexed for MEDLINE]

109: Biochemistry. 2000 Jun 20;39(24):7300-8. 

Intersubunit association induces unique allosteric dependence of the T127L CRP
mutant on pH.

Shi Y, Wang S, Schwarz FP.

Center for Advanced Research in Biotechnology/National Institute of Standards
and Technology, Rockville, MD 20850, USA.

The allosteric activation of the T127-->L mutant of 3',5'-cyclic adenosine
monophosphate (cAMP) receptor protein (CRP) by cAMP changes from an exothermic,
independent two-site binding mechanism at pH 7.0 to an endothermic, interacting
two-site binding mechanism at pH 5.2, similar to that observed for CRP at pH 7.0
and 5.2. Since the T127-->L mutation at the subunit interface of the CRP dimer
creates a more perfect leucine-zipper motif, it is believed to increase the
intersubunit association and the stability of the CRP, as is observed by the
higher thermal stability of the T127L mutant relative to that of CRP in
differential scanning calorimetry (DSC) measurements. The DSC scans also exhibit
a single thermal denaturation transition for CRP and a S128A mutant from pH 5.2
to 7. 0, while the broader transition peak of the T127L mutant becomes
resolvable into two transitions below pH < or =5.2. Circular dichroism
measurements on T127L and CRP at pH 7.0 and 5.2 show changes in the tertiary
structure of both proteins with the exception of the tertiary structure around
the two tryptophan residues in the amino-terminal domain. Although gel
electrophoresis of the proteolysis (pH 5.2) products of T127L, CRP, and their
cAMP- and cGMP-ligated complexes shows the subunit band and an amino-terminal
domain fragment band, the fully allosterically activated complexes of T127L and
CRP show the amino-terminal domain fragment band but not the subunit band. The
results are interpreted in terms of the allosteric activation of CRP by cAMP by
a conformational change from an "open" to a "closed" form of CRP, which involves
changes in the tertiary structure of the carboxyl-terminal domains that are
partially induced by an increase in the intersubunit association in T127L. While
T127L retains its intersubunit association from pH 5.2 to 7.0, changes occur in
the carboxyl-terminal domain so that the endothermic, allosteric activation
mechanism of CRP by cAMP is restored in T127L at pH 5.2.

PMID: 10852730 [PubMed - indexed for MEDLINE]

110: Genes Cells. 2000 Apr;5(4):239-50. 

Mechanism of catabolite repression in the bgl operon of Escherichia coli:
involvement of the anti-terminator BglG, CRP-cAMP and EIIAGlc in mediating
glucose effect downstream of transcription initiation.

Gulati A, Mahadevan S.

Department of Molecular Reproduction, Development and Genetics, Indian Institute
of Science, Bangalore 560 012, India.

BACKGROUND: Expression of the bgl operon of Escherichia coli, involved in the
regulated uptake and utilization of aromatic beta-glucosides, is extremely
sensitive to the presence of glucose in the growth medium. We have analysed the
mechanism by which glucose exerts its inhibitory effect on bgl expression.
RESULTS: Our studies show that initiation of transcription from the bgl promoter
is only marginally sensitive to glucose. Instead, glucose exerts a more
significant inhibition on the elongation of transcription beyond the
rho-independent terminator present within the leader sequence. Transcriptional
analyses using plasmids that carry mutations in bglG or within the terminator,
suggest that the target for glucose-mediated repression is the anti-terminator
protein, BglG. Introduction of multiple copies of bglG or the presence of
mutations that inhibit its phosphorylation by Enzyme IIBgl (BglF), result in
loss of glucose repression. Studies using crp, cya and crr strains show that
both CRP-cAMP and the Enzyme IIAGlc (EIIAGlc) are involved in the regulation.
Although transcription initiation is normal in a crp, cya double mutant, no
detectable transcription is seen downstream of the terminator, which is restored
by a mutation within the terminator. Transcription past the terminator is also
partly restored by the addition of exogenous cAMP to glucose-grown cultures of a
crp+ strain. Glucose repression is lost in the crr mutant strain. CONCLUSIONS:
The results summarized above indicate that glucose repression in the bgl operon
is mediated at the level of transcription anti-termination, and glucose affects
the activity of BglG by altering its phosphorylation by BglF. The CRP-cAMP
complex is also involved in this regulation. The results using the crr mutant
suggest a negative role for EIIAGlc in the catabolite repression of the bgl
genes.

PMID: 10792463 [PubMed - indexed for MEDLINE]

111: Mol Microbiol. 2000 Mar;35(6):1506-17. 

The ChiA (YheB) protein of Escherichia coli K-12 is an endochitinase whose gene
is negatively controlled by the nucleoid-structuring protein H-NS.

Francetic O, Badaut C, Rimsky S, Pugsley AP.

Unite de Genetique moleculaire, CNRS URA1773, Institut Pasteur, 25 rue du Dr
Roux, 75734 Paris, Cedex 15, France.

The chromosome of Escherichia coli K-12 contains a putative gene, yheB (chiA),
at centisome 74.7, whose product shows sequence similarity with chitinases of
bacterial and viral origin. We cloned the chiA (yheB) gene and demonstrated that
it codes for a 94.5 kDa periplasmic protein with endochitinase/lysozyme
activity. Under standard laboratory growth conditions, chiA expression is very
low, as shown by the Lac- phenotype of a chiA transcriptional fusion to a
promoterless lacZ reporter. To identify factors that control chitinase gene
expression, we generated random Tn10 insertions in the chromosome of the
fusion-containing strain, selecting for a Lac+ phenotype. The majority of the
mutations that caused a Lac+ phenotype mapped to the hns gene, encoding the
nucleoid-structuring protein H-NS. Transcription of chiA in vivo is driven by a
single sigma70 promoter and is derepressed in an hns mutant. Using a competitive
gel retardation assay, we demonstrated that H-NS binds directly and with high
affinity to the chiA promoter region. In addition to hns, other E. coli
mutations causing defects in global regulatory proteins, such as fis, crp or
stpA in combination with hns, increased chiA expression to different extents, as
did decreasing the growth temperature from 37 degrees C to 30 degrees C. A
possible physiological function of ChiA (YheB) endochitinase in E. coli K-12 is
discussed.

PMID: 10760150 [PubMed - indexed for MEDLINE]

112: Mol Microbiol. 2000 Mar;35(6):1383-93. 

Characterization of the Lactococcus lactis transcription factor FlpA and
demonstration of an in vitro switch.

Scott C, Guest JR, Green J.

The Krebs Institute for Biomolecular Research, Department of Molecular Biology
and Biotechnology, University of Sheffield, Western Bank, Sheffield S10 2TN, UK.

The commercially important bacterium Lactococcus lactis contains two FNR-like
proteins (FlpA and FlpB) which have a high degree of identity to each other and
to the FLP of Lactobacillus casei. FlpA was isolated from a GST-FlpA fusion
protein produced in Escherichia coli. Like FLP, isolated FlpA is a homodimeric
protein containing both Zn and Cu. However, the properties of FlpA were more
like those of the E. coli oxygen-responsive transcription factor FNR than the
FLP of L. casei. As prepared FlpA recognized an FNR site (TTGAT-N4-ATCAA) but
not an FLP site (CCTGA-N4-TCAGG) in band-shift assays. In contrast to FLP, DNA
binding by FlpA did not require the formation of an intramolecular disulphide
bond. However, despite containing only two cysteine residues per monomer, FlpA
was able to acquire an FNR-like, oxygen-labile [4Fe 4S] cluster. But, whereas
the incorporation of a [4Fe 4S] cluster into FNR enhances interaction with
target DNA, it abolished DNA binding by FlpA. An FlpA variant (FlpA') with an
N-terminal region designed to be more FLP-like failed to incorporate an
iron-sulphur cluster but could now form an intramolecular disulphide. This
simple example of protein engineering, converting an oxygen-labile [4Fe 4S]
containing FNR-like protein into a dithiol-disulphide FLP-like redox sensor
demonstrates the versatility of the basic CRP structure. Attempts to demonstrate
an FlpA-based aerobic-anaerobic switch in the heterologous host E. coli were
unsuccessful. However, studies with a series of FNR-dependent lac reporter
fusions in strains of E. coli expressing flpA or flpB revealed that both
homologues were able to activate expression of FNR-dependent promoters in vivo
but only when positioned 61 base pairs upstream of the transcription start.

PMID: 10760139 [PubMed - indexed for MEDLINE]

113: J Bacteriol. 2000 Apr;182(8):2314-20. 

The Yersinia enterocolitica phospholipase gene yplA is part of the flagellar
regulon.

Schmiel DH, Young GM, Miller VL.

Department of Molecular Microbiology, Department of Pediatrics, Washington
University School of Medicine, Missouri 63110, USA.

Yersinia enterocolitica yplA encodes a phospholipase required for virulence.
Virulence genes are often regulated in response to environmental signals;
therefore, yplA expression was examined using a yplA::lacZY transcriptional
fusion. Maximal yplA expression occurred between pH 6.5 and pH 7.5 and was
induced in the mid-logarithmic growth phase. Potential Fnr, cyclic AMP
(cAMP)-cAMP receptor protein (Crp), and sigma(F) regulatory sites were
identified in the nucleotide sequence. Reduction of yplA expression by aeration,
addition of glucose and sucrose, and application of high temperature and salt is
consistent with Fnr-, cAMP-Crp-, and sigma(F)-mediated regulation, respectively.
Expression of yplA was reduced in flhDC and fliA null strains, indicating that
yplA is part of the flagellar regulon.

PMID: 10735878 [PubMed - indexed for MEDLINE]

114: J Biol Chem. 2000 Mar 24;275(12):8480-6. 

Kinetic studies of cAMP-induced allosteric changes in cyclic AMP receptor
protein from Escherichia coli.

Malecki J, Polit A, Wasylewski Z.

Department of Physical Biochemistry, Institute of Molecular Biology,
Jagiellonian University, Al. Mickiewicza 3, 31-120 Krakow, Poland.

Cyclic AMP receptor protein (CRP) regulates the expression of several genes in
Escherichia coli. The ability of CRP to bind specific DNA sequences and
stimulate transcription is achieved as result of binding of an allosteric
ligand: cAMP. Stopped-flow fluorimetry was employed to study the kinetics of the
conformational changes in CRP induced by cAMP binding to high and low affinity
receptor sites. Results of experiments using CRP labeled at Cys-178 with
1,5-I-AENS indicate change in conformation of the helix-turn-helix, occurring
after the formation of CRP-cAMP(2) complex, i.e. after saturation of the high
affinity sites. The observed conformational change occurs according to
sequential model of allostery and is described by rate constants: k(c) = 9.7 +/-
0.1 s(-1) and k(-c) = 0.31 +/- 0.05 s(-1), for the forward and backward
reaction, respectively. Results of experiments monitored using CRP intrinsic
fluorescence suggest that conformational change precedes the formation of
CRP-cAMP(4) complex and results from displacement of equilibrium between two
forms of CRP-cAMP(2), caused by binding of cAMP to low affinity sites of one of
these forms only. The observed conformational change occurs according to
concerted model of allostery and is described by rate constants: k(on) = 28 +/-
1.5 s(-1) and k(off) = 75.5 +/- 3 s(-1). Results of experiments using
single-tryptophan-containing CRP mutants indicate that Trp-85 is mainly
responsible for the observed total change in intrinsic fluorescence of wild-type
CRP.

PMID: 10722684 [PubMed - indexed for MEDLINE]

115: J Bacteriol. 2000 Mar;182(5):1340-5. 

Characterization of SotA and SotB, two Erwinia chrysanthemi proteins which
modify isopropyl-beta-D-thiogalactopyranoside and lactose induction of the
Escherichia coli lac promoter.

Condemine G.

Unite Microbiologie et Genetique-composante INSA, UMR CNRS-INSA-UCB 5577, 69621
Villeurbanne, France. condemin@insa.insa-lyon.fr

The expression, in Escherichia coli, of variants of the Erwinia chrysanthemi
secretion genes outB and outS under the Ptac promoter is toxic to the cells.
During attempts to clone E. chrysanthemi genes able to suppress this toxicity, I
identified two genes, sotA and sotB, whose products are able to reduce the
isopropyl-beta-D-thiogalactopyranoside (IPTG) induction of the E. coli lac
promoter. SotA and SotB belong to two different families of the major
facilitator superfamily. SotA is a member of the sugar efflux transporter
family, while SotB belongs to the multidrug efflux family. The results presented
here suggest that SotA and SotB are sugar efflux pumps. SotA reduces the
intracellular concentration of IPTG, lactose, and arabinose. SotB reduces the
concentration of IPTG, lactose, and melibiose. Expression of sotA and sotB is
not regulated by their substrates, but sotA is activated by the cyclic AMP
receptor protein (CRP), while sotB is repressed by CRP. Lactose is weakly toxic
for E. chrysanthemi. This toxicity is increased in a sotB mutant which cannot
efficiently efflux lactose. This first evidence for a physiological role of
sugar efflux proteins suggests that their function could be to reduce the
intracellular concentration of toxic sugars or sugar metabolites.

PMID: 10671456 [PubMed - indexed for MEDLINE]

116: J Bacteriol. 2000 Jan;182(1):100-6. 

HbaR, a 4-hydroxybenzoate sensor and FNR-CRP superfamily member, regulates
anaerobic 4-hydroxybenzoate degradation by Rhodopseudomonas palustris.

Egland PG, Harwood CS.

Department of Microbiology, University of Iowa, Iowa City, Iowa 52242, USA.

Under anaerobic conditions, structurally diverse aromatic compounds are
catabolized by bacteria to form benzoyl-coenzyme A (benzoyl-CoA), the starting
compound for a central reductive pathway for aromatic ring degradation. The
structural genes required for the conversion of 4-hydroxybenzoate (4-HBA) to
benzoyl-CoA by Rhodopseudomonas palustris have been identified. Here we describe
a regulatory gene, hbaR, that is part of the 4-HBA degradation gene cluster. An
hbaR mutant that was constructed was unable to grow anaerobically on 4-HBA.
However, the mutant retained the ability to grow aerobically on 4-HBA by an
oxygen-requiring pathway distinct from the anaerobic route of 4-HBA degradation.
The effect of the HbaR protein on expression of hbaA encoding 4-HBA-CoA ligase,
the first enzyme for 4-HBA degradation, was investigated by using hbaA::'lacZ
transcriptional fusions. HbaR was required for a 20-fold induction of
beta-galactosidase activity that was observed with a chromosomal hbaA::'lacZ
fusion when cells grown anaerobically on succinate were switched to anaerobic
growth on succinate and 4-HBA. HbaR also activated expression from a
plasmid-borne hbaA-'lacZ fusion when it was expressed in aerobically grown
Pseudomonas aeruginosa cells, indicating that the activity of this regulator is
not sensitive to oxygen. The deduced amino acid sequence of HbaR indicates that
it is a member of the FNR-CRP superfamily of regulatory proteins. It is most
closely related to transcriptional activators that are involved in regulating
nitrate reduction. Previously, it has been shown that R. palustris has an FNR
homologue, called AadR, that is also required for 4-HBA degradation. Our
evidence indicates that AadR activates expression of hbaR in response to
anaerobiosis and that HbaR, in turn, activates expression of 4-HBA degradation
in response to 4-HBA as an effector molecule.

PMID: 10613868 [PubMed - indexed for MEDLINE]

117: Genet Anal. 1999 Dec 15;15(6):235-8. 

DNA region responsible for transcriptional regulation of the Escherichia coli
penicillin amidase (pac) gene by CRP and PAA.

Radoja S, Francetic O, Stojicevic N, Moric I, Glisin V, Konstantinovic M.

Institute of Molecular Genetics and Genetic Engineering, Belgrade, Yugoslavia.
radojs01@popmail.med.nyu.edu

Transcriptional regulation of Escherichia coli ATCC11105 penicillin amidase gene
(pac) by cAMP receptor protein (CRP) and phenylacetic acid (PAA) was studied by
using operon fusions with divergent reporter gene (lacZ, and phoA) constructs. A
150 bp DNA segment essential for the regulation of pac gene transcription by CRP
and PAA was defined.

PMID: 10609760 [PubMed - indexed for MEDLINE]

118: Genes Dev. 1999 Dec 1;13(23):3081-91. 

Erratum in:
    Genes Dev 2000 Feb 1;14(3):389.

The cAMP receptor protein CRP can function as an osmoregulator of transcription
in Escherichia coli.

Landis L, Xu J, Johnson RC.

Department of Biological Chemistry, School of Medicine, University of
California, Los Angeles, Los Angeles, California 90095-1737, USA.

Transcription of the P1 promoter of the Escherichia coli proP gene, which
encodes a transporter of osmoprotectants, is strongly induced by a shift to
hyperosmotic media. Unlike most other osmotically regulated promoters, the
induction occurs for a brief period of time, corresponding to the replacement of
intracellular K(+) glutamate with osmoprotecting compounds. This burst of proP
transcription is correlated with the osmolarity-dependent binding of the cAMP
receptor protein CRP to a site within the proP P1 promoter. We show that
CRP-cAMP functions as an osmotically sensitive repressor of proP P1
transcription in vitro. Binding of CRP to the proP promoter in vivo is
transiently destabilized after a hyperosmotic shift with kinetics that
correspond to the derepression of transcription, whereas Fis and Lac repressor
binding is not osmotically sensitive. Similar osmotic regulation of proP P1
transcription by the CRP* mutant implies that binding of cAMP is not responsible
for the unusual osmotic sensitivity of CRP activity. Osmotic regulation of CRP
activity is not limited to proP. Activation of the lac promoter by CRP is also
transiently inhibited after an osmotic upshift, as is the binding of CRP to the
galdelta4P1 promoter. These findings suggest that CRP functions in certain
contexts to regulate gene expression in response to osmotic changes, in addition
to its  role in catabolite control.

PMID: 10601034 [PubMed - indexed for MEDLINE]

119: J Bacteriol. 1999 Dec;181(24):7639-42. 

Evidence that expression of the Vibrio vulnificus hemolysin gene is dependent on
cyclic AMP and cyclic AMP receptor protein.

Bang YB, Lee SE, Rhee JH, Choi SH.

Department of Food Science and Technology, Institute of Biotechnology, Chonnam
National University, Kwang-Ju, 500-757.

Glucose repressed hemolysin production in Vibrio vulnificus. Promoter activity
of the hemolysin gene, vvh, assessed with a vvh-luxCDABE transcriptional fusion,
required cyclic AMP (cAMP) and cAMP receptor protein (CRP) in Escherichia coli.
Hemolysin production in V. vulnificus increased after the addition of cAMP and
was undetectable in a putative crp mutant, suggesting that vvh is also regulated
by cAMP-CRP in V. vulnificus.

PMID: 10601227 [PubMed - indexed for MEDLINE]

120: J Bacteriol. 1999 Dec;181(24):7500-8. 

Multiple control of flagellum biosynthesis in Escherichia coli: role of H-NS
protein and the cyclic AMP-catabolite activator protein complex in transcription
of the flhDC master operon.

Soutourina O, Kolb A, Krin E, Laurent-Winter C, Rimsky S, Danchin A, Bertin P.

Unite de Regulation de l'Expression Genetique, Institut Pasteur, 75724 Paris
Cedex 15, France.

Little is known about the molecular mechanism by which histone-like
nucleoid-structuring (H-NS) protein and cyclic AMP-catabolite activator protein
(CAP) complex control bacterial motility. In the present paper, we show that crp
and hns mutants are nonmotile due to a complete lack of flagellin accumulation.
This results from a reduced expression in vivo of fliA and fliC, which encode
the specific flagellar sigma factor and flagellin, respectively. Overexpression
of the flhDC master operon restored, at least in part, motility in crp and hns
mutant strains, suggesting that this operon is the main target for both
regulators. Binding of H-NS and CAP to the regulatory region of the master
operon was demonstrated by gel retardation experiments, and their DNA binding
sites were identified by DNase I footprinting assays. In vitro transcription
experiments showed that CAP activates flhDC expression while H-NS represses it.
In agreement with this observation, the activity of a transcriptional fusion
carrying the flhDC promoter was decreased in the crp strain and increased in the
hns mutant. In contrast, the activity of a transcriptional fusion encompassing
the entire flhDC regulatory region extending to the ATG translational start
codon was strongly reduced in both hns and crp mutants. These results suggest
that the region downstream of the +1 transcriptional start site plays a crucial
role in the positive control by H-NS of flagellum biosynthesis in vivo. Finally,
the lack of complementation of the nonmotile phenotype in a crp mutant by
activation-deficient CAP mutated proteins and characterization of cfs, a
mutation resulting in a CAP-independent motility behavior, demonstrate that CAP
activates flhDC transcription by binding to its promoter and interacting with
RNA polymerase.

PMID: 10601207 [PubMed - indexed for MEDLINE]

121: Genes Genet Syst. 1999 Jun;74(3):105-11. 

Structure and transcriptional control of the flagellar master operon of
Salmonella typhimurium.

Yanagihara S, Iyoda S, Ohnishi K, Iino T, Kutsukake K.

Faculty of Applied Biological Science, Hiroshima University, Japan.

The flhD and flhC genes constitute the flagellar master operon whose products
are required for expression of all the remaining flagellar operons in Salmonella
typhimurium. Here we report the molecular structure and in vivo and in vitro
expression of the flhD operon. Nucleotide sequence analysis revealed that the
upstream region of this operon contains the consensus sequence for the cAMP-CRP
binding site. Primer extension analysis demonstrated six possible transcription
start sites for this operon. They include CRP-dependent and CRP-repressible
transcription start sites. The CRP-dependent transcription start site is located
203 bp upstream of the initiation codon of the flhD gene and preceded by the
consensus sequences of the -10 and -35 regions of the sigma 70-dependent
promoter. The putative cAMP-CRP binding site is located centered 70 bp upstream
of this start site. The CRP-repressible transcription start site is located
within this putative cAMP-CRP binding site. These two start sites were confirmed
by in vitro transcription experiments using sigma 70-RNA polymerase with or
without cAMP-CRP.

PMID: 10586519 [PubMed - indexed for MEDLINE]

122: J Bacteriol. 1999 Dec;181(23):7373-80. 

Transcription regulation of the colicin K cka gene reveals induction of colicin
synthesis by differential responses to environmental signals.

Kuhar I, Zgur-Bertok D.

Department of Biology, Biotechnical Faculty, University of Ljubljana, Vecna pot
111, 1000 Ljubljana, Slovenia.

Colicin-producing strains occur frequently in natural populations of Escherichia
coli, and colicinogenicity seems to provide a competitive advantage in the
natural habitat. A cka-lacZ fusion was used to study the regulation of
expression of the colicin K structural gene. Expression is growth phase
dependent, with high activity in the late stationary phase. Nutrient depletion
induces the expression of cka due to an increase in ppGpp. Temperature is a
strong signal for cka expression, since only basal-level activity was detected
at 22 degrees C. Mitomycin C induction demonstrates that cka expression is
regulated to a lesser extent by the SOS response independently of ppGpp.
Increased osmolarity induces a partial increase, while the global regulator
integration host factor inhibits expression in the late stationary phase.
Induction of cka was demonstrated to be independent of the cyclic AMP-Crp
complex, carbon source, RpoS, Lrp, H-NS, pH, and short-chain fatty acids. In
contrast to colicin E1, cka expression is independent of catabolite repression
and is partially affected by anaerobiosis only upon SOS induction. These results
indicate that while different colicins are expressed in response to some common
signals such as nutrient depletion, the expression of individual colicins could
be further influenced by specific environmental cues.

PMID: 10572143 [PubMed - indexed for MEDLINE]

123: Mol Microbiol. 1999 Nov;34(3):562-75. 

Positive co-regulation of the Escherichia coli carnitine pathway cai and fix
operons by CRP and the CaiF activator.

Buchet A, Nasser W, Eichler K, Mandrand-Berthelot MA.

Laboratoire de Genetique Moleculaire des Microorganismes et des Interactions
Cellulaires, CNRS UMR 5577, Institut National des Sciences Appliquees, Batiment
406, 20, avenue Albert Einstein, F-69621 Villeurbanne Cedex, France.

Activation of the two divergent Escherichia coli cai and fix operons involved in
anaerobic carnitine metabolism is co-dependent on the cyclic AMP receptor
protein (CRP) and on CaiF, the specific carnitine-sensitive transcriptional
regulator. CaiF was overproduced using a phage T7 system, purified on a heparin
column and ran as a 15 kDa protein on SDS-PAGE. DNase I footprinting and
interference experiments identified two sites, F1 and F2, with apparently
comparable affinities for the binding of CaiF in the cai-fix regulatory region.
These sites share a common perfect inverted repeat comprising two 11 bp
half-sites separated by 13 bp, and centred at -70 and -127 from the fix
transcription start site. They were found to overlap the two low-affinity
binding sites, CRP2 and CRP3, determined previously for CRP. Gel shift assays
and footprinting experiments suggest that CaiF and CRP bind co-operatively to
the F1/CRP2 and F2/CRP3 sites of the intergenic cai-fix region. Moreover, they
appeared to serve the simultaneous binding of each other, giving rise to an
original multiprotein CRP-CaiF complex enabling RNA polymerase recruitment and
local DNA untwisting, at least at the fix promoter. Using random mutagenesis,
two CaiF mutants impaired in transcription activation were isolated. The
N-terminal A27V mutation affected the structural organization of the activator,
whereas the central I62N mutation was suggested to interfere with DNA binding.

PMID: 10564497 [PubMed - indexed for MEDLINE]

124: J Bacteriol. 1999 Sep;181(18):5624-35. 

Inactivation and regulation of the aerobic C(4)-dicarboxylate transport (dctA)
gene of Escherichia coli.

Davies SJ, Golby P, Omrani D, Broad SA, Harrington VL, Guest JR, Kelly DJ,
Andrews SC.

Krebs Institute for Biomolecular Research, Department of Molecular Biology and
Biotechnology, University of Sheffield, Sheffield S10 2TN, United Kingdom.

The gene (dctA) encoding the aerobic C(4)-dicarboxylate transporter (DctA) of
Escherichia coli was previously mapped to the 79-min region of the linkage map.
The nucleotide sequence of this region reveals two candidates for the dctA gene:
f428 at 79.3 min and the o157a-o424-o328 (or orfQMP) operon at 79.9 min. The
f428 gene encodes a homologue of the Sinorhizobium meliloti and Rhizobium
leguminosarum H(+)/C(4)-dicarboxylate symporter, DctA, whereas the orfQMP operon
encodes homologues of the aerobic periplasmic-binding protein- dependent
C(4)-dicarboxylate transport system (DctQ, DctM, and DctP) of Rhodobacter
capsulatus. To determine which, if either, of these loci specify the E. coli
DctA system, the chromosomal f428 and orfM genes were inactivated by inserting
Sp(r) or Ap(r) cassettes, respectively. The resulting f428 mutant was unable to
grow aerobically with fumarate or malate as the sole carbon source and grew
poorly with succinate. Furthermore, fumarate uptake was abolished in the f428
mutant and succinate transport was approximately 10-fold lower than that of the
wild type. The growth and fumarate transport deficiencies of the f428 mutant
were complemented by transformation with an f428-containing plasmid. No growth
defect was found for the orfM mutant. In combination, the above findings confirm
that f428 corresponds to the dctA gene and indicate that the orfQMP products
play no role in C(4)-dicarboxylate transport. Regulation studies with a
dctA-lacZ (f428-lacZ) transcriptional fusion showed that dctA is subject to
cyclic AMP receptor protein (CRP)-dependent catabolite repression and
ArcA-mediated anaerobic repression and is weakly induced by the DcuS-DcuR system
in response to C(4)-dicarboxylates and citrate. Interestingly, in a dctA mutant,
expression of dctA is constitutive with respect to C(4)-dicarboxylate induction,
suggesting that DctA regulates its own synthesis. Northern blot analysis
revealed a single, monocistronic dctA transcript and confirmed that dctA is
subject to regulation by catabolite repression and CRP. Reverse
transcriptase-mediated primer extension indicated a single transcriptional start
site centered 81 bp downstream of a strongly predicted CRP-binding site.

PMID: 10482502 [PubMed - indexed for MEDLINE]

125: Microbiology. 1999 Jul;145 ( Pt 7):1531-45. 

Erwinia carotovora has two KdgR-like proteins belonging to the IciR family of
transcriptional regulators: identification and characterization of the RexZ
activator and the KdgR repressor of pathogenesis.

Thomson NR, Nasser W, McGowan S, Sebaihia M, Salmond GP.

Department of Biochemistry, University of Cambridge, UK.

A novel Erwinia carotovora subsp. carotovora mutant designated RexZ, (regulator
of exoenzymes) showed reduced production of the degradative exoenzymes. The rexZ
gene product shows similarity of the KdgR regulatory protein from Erwinia
chrysanthemi, described as the major repressor of the pectin catabolism pathway
genes in the latter species. In vitro DNA-protein interaction experiments
demonstrated that the synthesis of the RexZ protein is controlled by the
cAMP-CRP (cAMP-receptor protein) complex. Western blot analysis also revealed
the presence of a second KdgR homologue (distinct from RexZ) which, like RexZ,
was present in all species of the genus Erwinia tested. The corresponding KdgR
proteins from both E. carotovora subsp. carotovora and E. carotovora subsp.
atroseptica share a high level of sequence identity with the KdgR homologues
from E. chrysanthemi and Escherichia coli. Although the E. carotovora subsp.
carotovora rexZ regulatory region displayed specific interactions with both the
purified E. chrysanthemi KdgR repressor and the partially purified E. carotovora
subsp. carotovora KdgR, in vivo quantification revealed that the cellular level
of RexZ protein was unaffected by the presence of pectic compounds. This study
shows that the complex regulatory network governing virulence in the erwinias
involves two totally distinct, but highly conserved, members of the IcIR class
of DNA binding proteins: RexZ and KdgR.

PMID: 10439393 [PubMed - indexed for MEDLINE]

126: J Biochem (Tokyo). 1999 Aug;126(2):354-60. 

Repression of the gene encoding succinate dehydrogenase in response to glucose
is mediated by the EIICB(Glc) protein in Escherichia coli.

Takeda S, Matsushika A, Mizuno T.

Laboratory of Molecular Microbiology, School of Agriculture, Nagoya University,
Chikusa-ku, Nagoya, 464-8601, Japan.

The Escherichia coli sdhCDAB operon encodes succinate dehydrogenase, an enzyme
complex involved in the tricarboxylic acid (TCA) cycle. Expression of this
operon is under complex transcriptional regulation in response to growth
conditions, such as anaerobiosis and carbon sources. Typically, the expression
of sdhCDAB is known to be subjected to "an aerobic repression" and "a glucose
repression." The molecular mechanism underlying the anaerobic repression has
been well documented, involving both the ArcB-ArcA two-component system and the
Fnr global anaerobic regulator. However, the mechanism underlying the glucose
repression is not yet clear, because the involvement of the general catabolite
regulators such as CRP and CRA has been dismissed. In this study, we conducted a
series of genetic analyses to identify the regulator gene(s) involved in the
glucose repression of sdh. The results demonstrate that the EIICB(Glc) protein
(the ptsG gene product), a component of the major glucose transporter, acts as a
crucial mediator in glucose repression. These results support the view that the
EIICB(Glc) protein functions not only as a glucose transporter, but also as a
glucose-sensing signal transducer that modulates the glucose repression of the
sdhCDAB operon.

PMID: 10423529 [PubMed - indexed for MEDLINE]

127: Fungal Genet Biol. 1999 Apr;26(3):253-69. 

Carbon regulation of ribosomal genes in Neurospora crassa occurs by a mechanism
which does not require Cre-1, the homologue of the Aspergillus carbon catabolite
repressor, CreA.

de la Serna I, Ng D, Tyler BM.

Department of Plant Pathology, University of California, Davis, California,
95616, USA.

Transcription of the ribosomal protein and 40S rRNA genes is coordinately
regulated during steady state growth and carbon shifts in Neurospora crassa.
Recognition sequences for the Aspergillus nidulans carbon catabolite repressor,
CreA, overlap transcriptional elements of a 40S rRNA gene and the crp-2
ribosomal protein gene. They also occur in similar locations in the promoters of
several other ribosomal protein genes. Substitutions encompassing the -74 and
-167 CreA consensus sequences in the crp-2 promoter result in a decrease in
transcription. A cDNA encoding the N. crassa homologue of CreA was cloned and
designated Cre-1. The Cre-1 protein is 45% identical to CreA from A. nidulans.
Cre-1 protein produced in Escherichia coli binds to the CreA sites in the
promoters of the 40S rRNA and crp-2 genes. An amino acid change from histidine
(92) to threonine changed the Cre-1 binding specificity from (5'G/CC/TGGG/AG3')
to (5'G/CC/TGGCG3'). Base substitutions in the Cre-1 binding sites of the crp-2
promoter disrupted binding of wildtype Cre-1 in vitro but had no effect on
transcription during steady state growth or carbon shifts, indicating that
regulation of ribosomal genes by carbon source is not mediated by Cre-1, but via
different proteins binding the Cre-1 sites and the Dde boxes. Copyright 1999
Academic Press.

PMID: 10361038 [PubMed - indexed for MEDLINE]

128: J Biol Chem. 1999 Jun 4;274(23):16010-9. 

Role of multiple CytR binding sites on cooperativity, competition, and induction
at the Escherichia coli udp promoter.

Gavigan SA, Nguyen T, Nguyen N, Senear DF.

Department of Molecular Biology and Biochemistry, University of California,
Irvine, California 92697, USA.

The CytR repressor fulfills dual roles as both a repressor of transcription from
promoters of the Escherichia coli CytR regulon and a co-activator in some
circumstances. Transcription is repressed by a three-protein complex (cAMP
receptor protein (CRP)-CytR-CRP) that is stabilized by cooperative interactions
between CRP and CytR. However, cooperativity also means that CytR can recruit
CRP and, by doing so, can act as a co-activator. The central role of
cooperativity in regulation is highlighted by the fact that binding of the
inducer, cytidine, to CytR is coupled to CytR-CRP cooperativity; this underlies
the mechanism for induction. Similar interactions at the different promoters of
the CytR regulon coordinate expression of the transport proteins and enzymes
required for nucleoside catabolism but also provide differential expression of
these genes. A fundamental question in both prokaryotic and eukaryotic gene
regulation is how combinatorial mechanisms of this sort regulate differential
expression. Recently, we showed that CytR binds specifically to multiple sites
in the E. coli deoP promoter, thereby providing competition for CRP binding to
CRP operator site 1 (CRP1) and CRP2 as well as cooperativity. The effect of the
competition at this promoter is to negate the role of CytR in recruiting CRP.
Here, we have used quantitative footprint and mobility shift analysis to
investigate CRP and CytR binding to the E. coli udp promoter. Here too, we find
that CytR both cooperates and competes for CRP binding. However, consistent with
both the distribution of CytR recognition motifs in the sequence of the promoter
and the regulation of the promoter, the competition is limited to CRP2. When
cytidine binds to CytR, the effect on cooperativity is very different at the udp
promoter than at the deoP2 promoter. Cooperativity with CRP at CRP1 is nearly
eliminated, but the effect on CytR-CRP2 cooperativity is negligible. These
results are discussed in relation to the current structural model of CytR in
which the core, inducer-binding domain is tethered to the helix-turn-helix,
DNA-binding domain via flexible peptide linkers.

PMID: 10347150 [PubMed - indexed for MEDLINE]

129: J Mol Biol. 1999 Apr 23;288(1):165-75. 

Protein-ligand interaction: grafting of the uridine-specific determinants from
the CytR regulator of Salmonella typhimurium to Escherichia coli CytR.

Thomsen LE, Pedersen M, Norregaard-Madsen M, Valentin-Hansen P, Kallipolitis BH.

Department of Molecular Biology, Odense University, Campusvej 55, Odense M,
DK-5230, Denmark.

Members of the LacI family of transcriptional repressors respond to the presence
of small effector molecules. The binding of the ligands affect the proteins
ability to repress transcription by stabilizing a conformation that, in most
cases, is unfavorable for high-affinity DNA binding. The CytR anti-activator
diverges from the other family members by relying on the cooperative DNA binding
with the global regulator CRP. The inducers of CytR do not affect CytR-DNA
binding per se, but alleviate repression by interrupting protein-protein
interactions between the two regulators. Here, we have studied of the
CytR-inducer interaction by exploring a discrepancy in the inducer response
observed for the homologous CytR regulators of Escherichia coli and Salmonella
typhimurium. CytR of S. typhimurium (CytRSt) appears to respond to the presence
of both uridine and cytidine nucleosides, whereas E. coli CytR (CytREc) responds
to cytidine only. We have used a combination of genetic and structural modeling
studies to provide detailed information regarding the nature of this
discrepancy. By analysis of hybrid CytR proteins followed by site-directed
mutagenesis, we have successfully transferred the specificity determinants for
uridine from CytRSt to CytREc, revealing that serine substitutions of only two
residues (G131 and A152) in CytREc is required to make CytREc sensitive to
uridine. In addition, by employing a genetic screen for induction of defective
mutants, we have identified four amino acid residues in CytRSt that appear to be
important for the response to uridine. The implications of these findings for
the understanding of the ligand binding and induction of CytR are discussed in
the context of the structural knowledge of CytR and homologous protein-ligand
complexes. Copyright 1999 Academic Press.

PMID: 10329134 [PubMed - indexed for MEDLINE]

130: Curr Opin Microbiol. 1999 Apr;2(2):148-52. 

Interplay of global regulators and cell physiology in the general stress
response of Escherichia coli.

Hengge-Aronis R.

Institute of Plant Physiology and Microbiology, Department of Biology, Free
University of Berlin, Konigin-Luise-Str 12-16a, 14195, Berlin, Germany.
Rhenggea@zedat.fu-berlin.de

Under various stress conditions, two sigma subunits of RNA polymerase, sigmaS
and sigma70, coexist in Escherichia coli cells. In contrast to sigma70, sigmaS
is subject to intricate regulation and coordinates an emergency reaction to
stress as well as long term stress adaptation. In vivo, the two sigma factors
clearly control different genes. Yet, they are structurally and functionally
very similar and basically recognize the same promoter sequences. Recent data
suggest that sigma factor specificity at stress-activated promoters is affected
by the interplay of the two RNA polymeraseholoenzymes with additional regulatory
factors, such as H-NS, Lrp, CRP, IHF or Fis, that differentially affect
transcription initiation by sigmaS or sigma70 in a promoter-specific manner.

Publication Types:
    Review
    Review, Tutorial

PMID: 10322169 [PubMed - indexed for MEDLINE]

131: Mol Microbiol. 1999 May;32(3):497-504. 

Dissection of a surface-exposed portion of the cAMP-CRP complex that mediates
transcription activation and repression.

Meibom KL, Sogaard-Andersen L, Mironov AS, Valentin-Hansen P.

Department of Molecular Biology, University of Odense, Campusvej 55, DK-5230
Odense M, Denmark.

The Escherichia coli cAMP receptor protein (CRP) is essential for the activation
and repression of transcription initiation at promoters in the CytR regulon. CRP
performs these activities by making direct protein-protein interactions to the
alpha-subunits of RNA polymerase and to the CytR regulator. Strikingly, it has
been shown that amino acids of CRP that are critical for communication with the
two partner proteins are located in close proximity on the surface of CRP. Here,
we have dissected this surface in order to pinpoint the 'repression region' of
CRP and to assess whether it overlaps with the characterized 'activating
region'. Our results established that residues 12, 13, 17, 105, 108 and 110 are
essential for the interaction with CytR and confirmed that 'activating region' 2
of CRP is made up of residues 19, 21 and 101. In the crystallographic structure
of the CRP-DNA complex, the two sets of determinants are located immediately
adjacent to each other forming a consecutive surface-exposed patch. The
'repression region' is chemically complementary to the characterized region on
CytR that is essential for protein-protein communication to CRP. Moreover, the
results provide insight into the mechanism by which CytR might prevent
CRP-mediated transcription.

PMID: 10320573 [PubMed - indexed for MEDLINE]

132: Genes Cells. 1999 Feb;4(2):87-97. 

Regulation of intrinsic terminator by translation in Escherichia coli:
transcription termination at a distance downstream.

Abe H, Abo T, Aiba H.

Department of Molecular Biology, Graduate School of Science, Nagoya University,
Chikusa, Nagoya 464-8602, Japan.

BACKGROUND: Rho-independent terminators in Escherichia coli are DNA sequences of
30-50 bp consisting of a GC-rich dyad symmetry sequence followed by a run of T
residues in the nontemplate strand. The transcription termination at the
Rho-independent terminator occurs within the T-tract in vitro. It has been
believed that the transcription termination at the Rho-independent terminator
occurs within the T-tract in vivo, as established in vitro, and therefore the 3'
ends of mRNAs are mostly generated as a direct result of transcription
termination. However, how the transcription termination occurs and how the 3'
ends of mRNAs are formed in living cells remains to be studied. RESULTS: We
developed a double terminator system in which a second Rho-independent
terminator was placed downstream of the crp terminator. This system made it
possible to detect transcripts that pass through the crp terminator by Northern
blotting. We found that most of the crp transcripts extend beyond the crp
terminator. The transcriptional read-through at the crp terminator was reduced
when the translation of crp mRNA was interrupted. The level of the read-through
transcript decreased with distance between the two terminators, suggesting that
transcription termination occurs at multiple positions beyond the crp
terminator. CONCLUSION: We conclude that most RNA polymerase reads through the
crp terminator in the natural situation and terminates transcription over a wide
region downstream of the crp terminator, resulting in heterogeneous primary
transcripts that are subsequently processed back to the terminator hairpin. We
propose that ribosome translation to the crp stop codon causes read-through of
the terminator. The regulatory effect of translation on Rho-independent
termination may be a general phenomenon at other operons.

PMID: 10320475 [PubMed - indexed for MEDLINE]

133: FEMS Microbiol Lett. 1999 May 1;174(1):125-30. 

Positively regulated expression of the Escherichia coli araBAD promoter in
Corynebacterium glutamicum.

Ben-Samoun K, Leblon G, Reyes O.

Institut de Genetique et Microbiologie URA 2225, Universite de Paris XI, Orsay,
France.

In Corynebacterium glutamicum the promoter of the araBAD Escherichia coli gene
is positively regulated by both arabinose and the araC gene product, as it is
the case in the natural host. If the L-arabinose inducer and an active araC gene
are present, significant amounts of araBAD promoter expression take place in the
absence of the E. coli CRP protein. These results show that the C. glutamicum
RNA polymerase is activated by the E. coli positive regulator of transcription
AraC.

PMID: 10234830 [PubMed - indexed for MEDLINE]

134: Mol Microbiol. 1999 Apr;32(2):327-43. 

Starvation-induced Mucts62-mediated coding sequence fusion: a role for ClpXP,
Lon, RpoS and Crp.

Lamrani S, Ranquet C, Gama MJ, Nakai H, Shapiro JA, Toussaint A, Maenhaut-Michel
G.

Laboratoire de Genetique des Procaryotes, Departement de Biologie Moleculaire,
Universite Libre de Bruxelles, 67 rue des Chevaux, B1640 Rhode St Genese,
Belgium.

The formation of araB-lacZ coding sequence fusions in Escherichia coli is a
particular type of chromosomal rearrangement induced by Mucts62, a
thermoinducible mutant of mutator phage Mu. Fusion formation is controlled by
the host physiology. It only occurs after aerobic carbon starvation and requires
the phage-encoded transposase pA, suggesting that these growth conditions
trigger induction of the Mucts62 prophage. Here, we show that thermal induction
of the prophage accelerated araB-lacZ fusion formation, confirming that
derepression is a rate-limiting step in the fusion process. Nonetheless,
starvation conditions remained essential to complete fusions, suggesting
additional levels of physiological regulation. Using a transcriptional fusion
indicator system in which the Mu early lytic promoter is fused to the reporter
E. coli lacZ gene, we confirmed that the Mucts62 prophage was derepressed in
stationary phase (S derepression) at low temperature. S derepression did not
apply to prophages that expressed the Mu wild-type repressor. It depended upon
the host ClpXP and Lon ATP-dependent proteases and the RpoS stationary
phase-specific sigma factor, but not upon Crp. None of these four functions was
required for thermal induction. Crp was required for fusion formation, but only
when the Mucts62 prophage encoded the transposition/replication activating
protein pB. Finally, we found that thermally induced cultures did not return to
the repressed state when shifted back to low temperature and, hence, remained
activated for accelerated fusion formation upon starvation. The maintenance of
the derepressed state required the ClpXP and Lon host proteases and the prophage
Ner-regulatory protein. These observations illustrate how the cts62 mutation in
Mu repressor provides the prophage with a new way to respond to growth
phase-specific regulatory signals and endows the host cell with a new potential
for adaptation through the controlled use of the phage transposition machinery.

PMID: 10231489 [PubMed - indexed for MEDLINE]

135: Mol Plant Microbe Interact. 1999 May;12(5):385-90. 

Self-regulation of pir, a regulatory protein responsible for hyperinduction of
pectate lyase in Erwinia chrysanthemi EC16.

Nomura K, Nasser W, Tsuyumu S.

Faculty of Agriculture, Shizuoka University, Japan.

Previously, we have cloned and characterized the pir (plant inducible regulator)
gene, which is responsible for hyperinduction of the synthesis of an isozyme of
pectate lyase (PLe) in Erwinia chrysanthemi EC16 in the presence of potato
extract and sodium polypectate (NaPP). The Pir protein purified from Escherichia
coli overexpressing pir is able to bind to the promoter region of pir as a
dimer. Self-regulation of pir by its own translational product (Pir) was
suggested from the findings that Pir binds at the promoter region of pir and
that the hyperinduction of the pirlux construct in response to plant extract was
observed only in pir+ but not in pir mutant EC16. Thus, hyperinduction of PLe
was thought to be mainly due to overproduction of Pir. On the other hand, KdgR
and PecS, which have been reported to be the major regulatory proteins for the
synthesis of pectic enzymes, did not bind to the promoter region of pir. Thus,
the regulation of Pir synthesis seems to be independent of KdgR and PecS. Also,
its expression was insensitive to catabolite repression as predicted from
failure of cyclic AMP (cAMP)-CRP (cAMP recognizing protein) to bind at the pir
promoter region.

PMID: 10226371 [PubMed - indexed for MEDLINE]

136: Biotechnol Bioeng. 1998 Jul 20;59(2):248-59. 

Generating controlled reducing environments in aerobic recombinant Escherichia
coli fermentations: effects on cell growth, oxygen uptake, heat shock protein
expression, and in vivo CAT activity.

Gill RT, Cha HJ, Jain A, Rao G, Bentley WE.

Center for Agricultural Biotechnology, University of Maryland Biotechnology
Institute and Department of Chemical Engineering, University of Maryland,
College Park, Maryland 20742, USA.

The independent control of culture redox potential (CRP) by the regulated
addition of a reducing agent, dithiothreitol (DTT) was demonstrated in aerated
recombinant Escherichia coli fermentations. Moderate levels of DTT addition
resulted in minimal changes to specific oxygen uptake, growth rate, and
dissolved oxygen. Excessive levels of DTT addition were toxic to the cells
resulting in cessation of growth. Chloramphenicol acetyltransferase (CAT)
activity (nmoles/microgram total protein min.) decreased in batch fermentation
experiments with respect to increasing levels of DTT addition. To further
investigate the mechanisms affecting CAT activity, experiments were performed to
assay heat shock protein expression and specific CAT activity (nmoles/microgram
CAT min.). Expression of such molecular chaperones as GroEL and DnaK were found
to increase after addition of DTT. Additionally, sigma factor 32 (sigma32) and
several proteases were seen to increase dramatically during addition of DTT.
Specific CAT activity (nmoles/microgram CAT min. ) varied greatly as DTT was
added, however, a minimum in activity was found at the highest level of DTT
addition in E. coli strains RR1 [pBR329] and JM105 [pROEX-CAT]. In conjunction,
cellular stress was found to reach a maximum at the same levels of DTT. Although
DTT addition has the potential for directly affecting intracellular protein
folding, the effects felt from the increased stress within the cell are likely
the dominant effector. That the effects of DTT were measured within the
cytoplasm of the cell suggests that the periplasmic redox potential was also
altered. The changes in specific CAT activity, molecular chaperones, and other
heat shock proteins, in the presence of minimal growth rate and oxygen uptake
alterations, suggest that the ex vivo control of redox potential provides a new
process for affecting the yield and conformation of heterologous proteins in
aerated E. coli fermentations. Copyright 1998 John Wiley & Sons, Inc.

PMID: 10099335 [PubMed - indexed for MEDLINE]

137: J Bacteriol. 1999 Mar;181(6):1912-9. 

The cyclic AMP receptor protein is dependent on GcvA for regulation of the gcv
operon.

Wonderling LD, Stauffer GV.

Department of Microbiology, The University of Iowa, Iowa City, Iowa 52242, USA.

The Escherichia coli gcv operon is transcriptionally regulated by the GcvA,
GcvR, Lrp, and PurR proteins. In this study, the cyclic AMP (cAMP) receptor
protein (CRP) is shown to be involved in positive regulation of the gcv operon.
A crp deletion reduced expression of a gcvT-lacZ fusion almost fourfold in
glucose minimal (GM) medium. The phenotype was complemented by both the
wild-type crp gene and four crp alleles that encode proteins with amino acid
substitutions in known activating regions of CRP. A cyaA deletion also resulted
in a fourfold decrease in gcvT-lacZ expression, and wild-type expression was
restored by the addition of cAMP to the growth medium. A cyaA crp double
deletion resulted in levels of gcvT-lacZ expression identical to those observed
with either single mutation, showing that CRP and cAMP regulate through the same
mechanism. Growth in GM medium plus cAMP or glycerol minimal medium did not
result in a significant increase in gcvT-lacZ expression. Thus, the level of
cAMP present in GM medium appears to be sufficient for regulation by CRP. DNase
I footprint analysis showed that CRP binds and protects two sites centered at bp
-313 (site 1) and bp -140 (site 2) relative to the transcription initiation
site, but a mutational analysis demonstrated that only site 1 is required for
CRP-mediated regulation of gcvT-lacZ expression. Expression of the gcvT-lacZ
fusion in a crp gcvA double mutant suggested that CRP's role is dependent on the
GcvA protein.

PMID: 10074087 [PubMed - indexed for MEDLINE]

138: J Bacteriol. 1999 Mar;181(6):1892-9. 

Catabolic repression of secB expression is positively controlled by cyclic AMP
(cAMP) receptor protein-cAMP complexes at the transcriptional level.

Seoh HK, Tai PC.

Department of Biology, Georgia State University, Atlanta, Georgia 30303, USA.

SecB, a protein export-specific chaperone, enhances the export of a subset of
proteins across cytoplasmic membranes of Escherichia coli. Previous studies
showed that the synthesis of SecB is repressed by the presence of glucose in the
medium. The derepression of SecB requires the products of both the cya and crp
genes, indicating that secB expression is under the control of catabolic
repression. In this study, two secB-specific promoters were identified. In
addition, 5' transcription initiation sites from these two promoters were
determined by means of secB-lacZ fusions and primer extension. The distal P1
promoter appeared to be independent of carbon sources, whereas the proximal P2
promoter was shown to be subject to control by the cyclic AMP (cAMP) receptor
protein (CRP)-cAMP complexes. Gel-mobility shift studies showed that this
regulation results from direct interaction between the secB P2 promoter region
and the CRP-cAMP complex. Moreover, the CRP binding site on the secB gene was
determined by DNase I footprinting and further substantiated by mutational
analysis. The identified secB CRP binding region is centered at the -61.5 region
of the secB gene and differed from the putative binding sites predicted by
computer analysis.

PMID: 10074084 [PubMed - indexed for MEDLINE]

139: Microbiology. 1998 Dec;144 ( Pt 12):3317-25. 

Analysis of the effect exerted by extracellular pH on the maltose regulon in
Escherichia coli K-12.

Alonzo S, Heyde M, Laloi P, Portalier R.

Centre de Genetique Moleculaire et Cellulaire, UMR CNRS 5534, Universite Claude
Bernard, Villeurbanne, France.

The Escherichia coli maltose regulon consists of five operons under the control
of the MalT transcriptional activator. lac operon fusions were constructed in
vitro with the MalT-dependent promoter and with the malT promoter itself.
beta-Galactosidase activity displayed by these fusions during growth at
different external pH (pHo) revealed that growth at a pHo higher than 6
stimulates the transcription of malT- and MalT-controlled genes in the absence
or presence of maltose. Using a malTp1 malTp10 promoter that is cAMP-CRP (cAMP
receptor protein)-independent, it was demonstrated that CRP is essential for
malT pHo regulation and that the pHo-dependent activity of malKp is a direct
consequence of malT regulation. The pHo regulation displayed by a deleted but
still functional malT promoter fused to lacZ demonstrates that this minimal
promoter contains all the regulatory regions for establishing pHo regulation. In
the absence of MIc, a repressor of malT expression, the pHo regulation of malT
was still effective. It is proposed that binding of cAMP-CRP at malTp may be
affected by malTp topology induced by pHo or that a pHo-dependent effector may
act in concert with the cAMP-CRP complex.

PMID: 9884223 [PubMed - indexed for MEDLINE]

140: J Bacteriol. 1998 Dec;180(24):6586-96. 

Transcriptional regulation and organization of the dcuA and dcuB genes, encoding
homologous anaerobic C4-dicarboxylate transporters in Escherichia coli.

Golby P, Kelly DJ, Guest JR, Andrews SC.

The School of Animal & Microbial Sciences, University of Reading, Reading RG6
6AJ, United Kingdom.

The dcuA and dcuB genes of Escherichia coli encode homologous proteins that
appear to function as independent and mutually redundant C4-dicarboxylate
transporters during anaerobiosis. The dcuA gene is 117 bp downstream of, and has
the same polarity as, the aspartase gene (aspA), while dcuB is 77 bp upstream
of, and has the same polarity as, the anaerobic fumarase gene (fumB). To learn
more about the respective roles of the dcu genes, the environmental and
regulatory factors influencing their expression were investigated by generating
and analyzing single-copy dcuA- and dcuB-lacZ transcriptional fusions. The
results show that dcuA is constitutively expressed whereas dcuB expression is
highly regulated. The dcuB gene is strongly activated anaerobically by FNR,
repressed in the presence of nitrate by NarL, and subject to cyclic AMP receptor
protein (CRP)-mediated catabolite repression. In addition, dcuB is strongly
induced by C4-dicarboxylates, suggesting that dcuB is under the control of an
uncharacterized C4-dicarboxylate-responsive gene regulator. Northern blotting
confirmed that dcuA (and aspA) is expressed under both aerobic and anaerobic
conditions and that dcuB (and fumB) is induced anaerobically. Major
monocistronic transcripts were identified for aspA and dcuA, as well as a minor
species possibly corresponding to an aspA-dcuA cotranscript. Five major
transcripts were observed for dcuB and fumB: monocistronic transcripts for both
fumB and dcuB; a dcuB-fumB cotranscript; and two transcripts, possibly
corresponding to dcuB-fumB and fumB mRNA degradation products. Primer extension
analysis revealed independent promoters for aspA, dcuA, and dcuB, but
surprisingly no primer extension product could be detected for fumB. The
expression of dcuB is entirely consistent with a primary role for DcuB in
mediating C4-dicarboxylate transport during anaerobic fumarate respiration. The
precise physiological purpose of DcuA remains unclear.

PMID: 9852003 [PubMed - indexed for MEDLINE]

141: J Bacteriol. 1998 Dec;180(24):6476-83. 

The EIIGlc protein is involved in glucose-mediated activation of Escherichia
coli gapA and gapB-pgk transcription.

Charpentier B, Bardey V, Robas N, Branlant C.

Maturation des ARN et Enzymologie Moleculaire, UMR CNRS 7567, Universite H.
Poincare, Faculte des Sciences, 54506 Vandoeuvre-les-Nancy, Cedex, France.

The Escherichia coli gapB gene codes for a protein that is very similar to
bacterial glyceraldehyde-3-phosphate dehydrogenases (GAPDH). In most bacteria,
the gene for GAPDH is located upstream of the pgk gene encoding
3-phosphoglycerate kinase (PGK). This is the case for gapB. However, this gene
is poorly expressed and encodes a protein with an erythrose 4-phosphate
dehydrogenase activity (E4PDH). The active GAPDH is encoded by the gapA gene.
Since we found that the nucleotide region upstream of the gapB open reading
frame is responsible for part of the PGK production, we analyzed gapB promoter
activity in vivo by direct measurement of the mRNA levels by reverse
transcription. We showed the presence of a unique transcription promoter, gapB
P0, with a cyclic AMP (cAMP) receptor protein (CRP)-cAMP binding site centered
70.5 bp upstream of the start site. Interestingly, the gapB P0 promoter activity
was strongly enhanced when glucose was used as the carbon source. In these
conditions, deletion of the CRP-cAMP binding site had little effect on promoter
gapB P0 activity. In contrast, abolition of CRP production or of cAMP
biosynthesis (crp or cya mutant strains) strongly reduced promoter gapB P0
activity. This suggests that in the presence of glucose, the CRP-cAMP complex
has an indirect effect on promoter gapB P0 activity. We also showed that glucose
stimulation of gapB P0 promoter activity depends on the expression of enzyme
IIGlc (EIIGlc), encoded by the ptsG gene, and that the gapA P1 promoter is also
activated by glucose via the EIIGlc protein. A similar glucose-mediated
activation, dependent on the EIIGlc protein, was described by others for the pts
operon. Altogether, this shows that when glucose is present in the growth medium
expression of the E. coli genes required for its uptake (pts) and its metabolism
(gapA and gapB-pgk) are coordinately activated by a mechanism dependent upon the
EIIGlc protein.

PMID: 9851989 [PubMed - indexed for MEDLINE]

142: Can J Microbiol. 1998 Aug;44(8):707-17. 

Regulation in the rpoS regulon of Escherichia coli.

Loewen PC, Hu B, Strutinsky J, Sparling R.

Department of Microbiology, University of Manitoba, Winnipeg, Canada.

In Escherichia coli, the transcription factor sigma s, encoded by rpoS, controls
the expression of a large number of genes involved in cellular responses to a
diverse number of stresses, including starvation, osmotic stress, acid shock,
cold shock, heat shock, oxidative DNA damage, and transition to stationary
phase. A list of over 50 genes under the control of rpoS has been compiled. The
transcription factor sigma s acts predominantly as a positive effector, but it
does have a negative effect on some genes. The synthesis and accumulation of
sigma s are controlled by mechanisms affecting transcription, translation,
proteolysis, and the formation of the holoenzyme complex. Transcriptional
control of rpoS involves guanosine 3',5'-bispyrophosphate (ppGpp) and
polyphosphate as positive regulators and the cAMP receptor protein-cAMP complex
(CRP-cAMP) as a negative regulator. Translation of rpoS mRNA is controlled by a
cascade of interacting factors, including Hfq, H-NS, dsrA RNA, LeuO, and oxyS
RNA that seem to modulate the stability of a region of secondary structure in
the ribosome-binding region of the gene's mRNA. The transcription factor sigma s
is sensitive to proteolysis by ClpPX in a reaction that is promoted by RssB and
inhibited by the chaperone DnaK. Despite the demonstrated involvement of so many
factors, arguments have been presented suggesting that sensitivity to
proteolysis may be the single most important modulator of sigma s levels. The
activity of sigma s may also be modulated by trehalose and glutamate, which
activate holoenzyme formation and promote holoenzyme binding to certain
promoters.

Publication Types:
    Review

PMID: 9830102 [PubMed - indexed for MEDLINE]

143: J Bacteriol. 1998 Dec;180(23):6173-86. 

Integration host factor and cyclic AMP receptor protein are required for
TyrR-mediated activation of tpl in Citrobacter freundii.

Bai Q, Somerville RL.

Department of Biochemistry, Purdue University, West Lafayette, Indiana 47907,
USA.

The tpl gene of Citrobacter freundii encodes an enzyme that catalyzes the
conversion of L-tyrosine to phenol, pyruvate, and ammonia. This gene is known to
be positively regulated by TyrR. The amplitude of regulation attributable to
this transcription factor is at least 20-fold. Three TyrR binding sites,
designated boxes A, B, and C, centered at coordinates -272.5, -158.5, and -49.5,
respectively, were identified in the upstream region of the tpl promoter. The
results of mutational experiments suggest that TyrR binds in cooperative fashion
to these sites. The nonavailability of any TyrR site impairs transcription. Full
TyrR-mediated activation of tpl required integration host factor (IHF) and the
cAMP receptor protein (CRP). By DNase I footprinting, it was shown that the IHF
binding site is centered at coordinate -85 and that there are CRP binding sites
centered at coordinates -220 and -250. Mutational alteration of the IHF binding
site reduced the efficiency of the tpl promoter by at least eightfold. The
proposed roles of CRP and IHF are to introduce bends into tpl promoter DNA
between boxes A and B or B and C. Multimeric TyrR dimers were demonstrated by a
chemical cross-linking method. The formation of hexameric TyrR increased when
tpl DNA was present. The participation of both IHF and CRP in the activation of
the tpl promoter suggests that molecular mechanisms quite different from those
that affect other TyrR-activated promoters apply to this system. A model wherein
TyrR, IHF, and CRP collaborate to regulate the expression of the tpl promoter is
presented.

PMID: 9829925 [PubMed - indexed for MEDLINE]

144: Genetika. 1998 Aug;34(8):1063-72. 

[Role of additional binding sites for the CytR protein in the regulation of
Escherichia coli udp gene expression]

[Article in Russian]

Domakova EV, Errais LL, Eremina SIu, Mironov AS.

State Research Institute of Genetics and Selection of Industrial Microorganisms,
Moscow, Russia. lab25@vnigen.msk.su

The nucleotide sequence of a 1000-bp fragment of the Escherichia coli chromosome
located between genes metE and udp and including the promoter region of the udp
gene was determined. Multiple binding sites for the CytR and CRP proteins were
identified outside the canonical udp gene promoter. A set of deletion variants
with the truncated regulatory region of the udp gene was isolated based on
plasmids pSKII and pJEL250. The level of CytR regulation of the udp gene was
shown to depend on the size of the regulatory region relative to the
transcription initiation site. On the basis of these data, it is concluded that
additional binding sites for the CytR protein located in the regulatory region
are functionally active in the regulation of udp gene expression. This
conclusion has been confirmed by properties of the udp264 promoter mutant, which
contains a deletion covering the main CytR binding site within the canonical
promoter. Irrespective of the deletion, the expression of the udp gene in mutant
udpP264 retains the dependence on the allelic state of the cytR gene. The CytR
protein was shown to act as a transcription repressor or activator, depending on
the configuration of the promoter and on the relative location and quantity of
binding sites for CytR and CRP proteins.

PMID: 9777353 [PubMed - indexed for MEDLINE]

145: FEMS Microbiol Lett. 1998 Sep 15;166(2):213-7. 

Activation of a consensus FNR-dependent promoter by DNR of Pseudomonas
aeruginosa in response to nitrite.

Hasegawa N, Arai H, Igarashi Y.

Department of Biotechnology, University of Tokyo, Japan.

Expression of the enzymes for anaerobic nitrate respiration of Pseudomonas
aeruginosa requires two CRP/FNR-related transcriptional regulators, ANR and DNR.
Activity of the consensus CRP- or FNR-dependent promoter in the anr and dnr
deficient mutants was investigated. The CRP-dependent promoter was active in the
mutant strains. Both regulators could activate the promoter with a consensus
FNR-binding motif. DNR-dependent activation was nitrite-dependent, whereas
activation by ANR was not, suggesting that only DNR is involved in sensing
nitrogen oxides.

PMID: 9770276 [PubMed - indexed for MEDLINE]

146: Mol Microbiol. 1998 Aug;29(4):1091-9. 

Comment in:
    Mol Microbiol. 1999 Jan;31(1):393.

Transcription of rpoH, encoding the Escherichia coli heat-shock regulator
sigma32, is negatively controlled by the cAMP-CRP/CytR nucleoprotein complex.

Kallipolitis BH, Valentin-Hansen P.

Department of Molecular Biology, Odense University, Denmark.

In Escherichia coli, the rpoH gene encoding the essential heat-shock regulator
sigma32, is expressed in a complex manner. Transcription occurs from four
promoters (P1, P3, P4 and P5) and is modulated by several factors including (i)
two sigma factors (sigma70 and sigmaE); (ii) the global regulator CRP; and (iii)
the DnaA protein. Here, a further dissection of the rpoH regulatory region has
revealed that an additional transcription control exists that appears to link
rpoH expression to nucleoside metabolism. The cAMP-CRP complex and the CytR
anti-activator bind co-operatively to the promoter region forming a repression
complex that overlaps the sigmaE-dependent P3 promoter and the sigma70-dependent
P4 and P5 promoters. During steady-state growth conditions with glycerol as the
carbon and energy source, transcription from P3, P4 and P5 is reduced
approximately threefold by CytR, whereas transcription from the upstream
promoter, P1, appears to be unaffected. Furthermore, in strains that slightly
overproduce CytR, transcription from P3, P4 and P5 is reduced even further
(approximately 10-fold), and repression can be fully neutralized by the addition
of the inducer cytidine to the growth medium. In the induced state, P4 is the
strongest promoter and, together with P3 and P5, it is responsible for most rpoH
transcription (65-70%). At present, CytR has been shown to 'fine tune'
transcription of two genes (rpoH and ppiA) that are connected with
protein-folding activities. These findings suggest that additional assistance in
protein folding is required under conditions in which CytR is induced (i.e. in
the presence of nucleosides).

PMID: 9767576 [PubMed - indexed for MEDLINE]

147: Methods Enzymol. 1998;295:403-24. 

Analysis of interactions between CytR and CRP at CytR-regulated promoters.

Senear DF, Perini LT, Gavigan SA.

Department of Molecular Biology and Biochemistry, University of California,
Irvine 92697, USA.

PMID: 9750230 [PubMed - indexed for MEDLINE]

148: Mol Gen Genet. 1998 Aug;259(3):317-26. 

CRP down-regulates adenylate cyclase activity by reducing the level of
phosphorylated IIA(Glc), the glucose-specific phosphotransferase protein, in
Escherichia coli.

Takahashi H, Inada T, Postma P, Aiba H.

Department of Molecular Biology, Graduate School of Science, Nagoya University,
Chikusa, Japan.

The cellular cAMP level is markedly down-regulated by cAMP receptor protein
(CRP) in Escherichia coli. CRP regulates adenylate cyclase both at the level of
transcription of its structural gene cya and at the level of enzyme activity. We
established a method to determine the phosphorylation state of IIA(Glc), the
glucose-specific phosphotransferase protein, in intact cells. We found that
IIA(Glc) exists predominantly in the unphosphorylated form in wild-type cells
growing in LB medium, while it is largely phosphorylated in crp or cya cells.
Disruption of the ptsG gene that codes for the membrane component of the major
glucose transporter (IICB(Glc)), and/or the fruF gene coding for FPr
(fructose-specific hybrid phosphotransferase protein), did not affect the
phosphorylation state of IIA(Glc). When IICB(Glc) was overproduced in the
presence of glucose, the levels of both cAMP and phosphorylated IIA(Glc) in crp
cells were concomitantly decreased to wild-type levels. In addition, when His-90
in IIA(Glc) was replaced by glutamine, both phosphorylation of IIA(Glc) and the
overproduction of cAMP in crp cells were eliminated. We also found that extracts
of crp+ cells markedly stimulate dephosphorylation of IIA(Glc)-P in vitro. We
conclude that CRP-cAMP down-regulates adenylate cyclase primarily by reducing
the level of phosphorylated IIA(Glc). The data suggest that unspecified proteins
whose expression is under the control of CRP-cAMP are responsible for this
regulation.

PMID: 9749675 [PubMed - indexed for MEDLINE]

149: Microbiology. 1998 Aug;144 ( Pt 8):2131-40. 

Glutamate and cyclic AMP regulate the expression of galactokinase in
Mycobacterium smegmatis.

Raychaudhuri S, Basu M, Mandal NC.

Department of Biochemistry, Bose Institute, Calcutta, India.

It was found that Mycobacterium smegmatis is unable to utilize galactose as the
sole carbon source because the sugar alone cannot induce galactokinase. However,
galactokinase was induced by glutamate alone, and was further stimulated by
galactose. Rifampicin completely inhibited the glutamate-mediated expression of
galK in both the absence and presence of galactose. Extracellular cAMP
stimulated the expression of the enzyme only in the presence of glutamate plus
galactose. The galK gene from M. smegmatis, including its upstream promoter
region, was cloned in a plasmid in Escherichia coli. The expression of kinase
from these clones in E. coli was dependent on cAMP and its receptor protein
(CRP). The expression of UDP-galactose 4-epimerase was constitutive. This and
other evidence suggests that the galK gene is not linked to galT and galE in the
mycobacterial genome. In a glutamate-independent galactose-utilizing mutant
(gin-1 mutant) of M. smegmatis, galK was expressed in the absence of both
galactose and glutamate, while in the presence of galactose this expression was
increased twofold in the absence of glutamate and fourfold in its presence.
Extracellularly added cAMP reduced the expression of the enzyme in the presence
of galactose plus glutamate nearly to the basal level. It is proposed that in M.
smegmatis the galK gene is expressed from two different promoters; the
expression from one promoter is dependent on glutamate but not on galactose and
cAMP, while that from the other requires all three components. The role of
galactose is possibly to derepress the latter promoter.

PMID: 9720034 [PubMed - indexed for MEDLINE]

150: Microbiology. 1998 Aug;144 ( Pt 8):2113-23. 

Transcription and transcript processing in the sdhCDAB-sucABCD operon of
Escherichia coli.

Cunningham L, Guest JR.

Krebs Institute for Biomolecular Research, Department of Molecular Biology and
Biotechnology, University of Sheffield, UK.

The genes encoding succinate dehydrogenase (sdhCDAB), the specific components of
the 2-oxoglutarate dehydrogenase complex (ODH, E1o and E2o; sucAB) and
succinyl-CoA synthetase (sucCD) form a cluster containing two promoters at 16.3
min in the chromosome of Escherichia coli: Psdh sdhCDAB-Psuc sucAB-sucCD. The
gene encoding the lipoamide dehydrogenase component of both the 2-oxoglutarate
and pyruvate dehydrogenase complexes (E3; lpdA) is the distal gene of another
cluster containing two promoters located at 2.7 min: Ppdh pdhR-aceEF-Plpd lpdA.
The responses of the suc and lpd promoters to different environmental conditions
and to regulator defects were investigated with appropriate lacZ fusions, in
order to understand how expression of the sucAB genes is co-regulated with other
genes in the sdhCDAB-sucABCD cluster and with lpdA expression. Expression from
the suc promoter was repressed by IHF and partially activated by sigma 38 but it
was not regulated by ArcA, FNR, CRP, FruR or Fis, and not repressed by glucose
or anaerobiosis, indicating that the well-established catabolite and anaerobic
repression of ODH synthesis is imposed elsewhere. In contrast, the lpd promoter
was repressed by both glucose (via a CRP-independent mechanism) and anaerobiosis
(mediated by ArcA), and activated by Fis, but it was not regulated by FNR, FruR,
IHF or sigma 38. These observations support the view that transcription of the
sucABCD genes is primarily initiated and regulated at the upstream sdh promoter,
and that the lpd promoter is independently co-regulated with Psdh (primarily by
ArcA-mediated repression) rather than with Psuc. Direct evidence for
co-transcription of the entire sdhCDAB-sucABCD region from Psdh was obtained by
detecting a 10 kb transcript in rnc and rne mutants, but not in the parental
strains. Three RNaseIII-specific processing sites, which contribute to the
extreme instability of the readthrough transcript, were identified in the
sdhCDAB-sucABCD intergenic region. Other sites of endonuclease processing were
located by interpreting the patterns of transcript subfragments observed in
Northern blotting.

PMID: 9720032 [PubMed - indexed for MEDLINE]

151: Vet Microbiol. 1998 Feb 28;60(2-4):227-38. 

An avian pathogenic Escherichia coli strain produces a hemolysin, the expression
of which is dependent on cyclic AMP receptor protein gene function.

Nagai S, Yagihashi T, Ishihama A.

Nippon Institute for Biological Science, Tokyo, Japan.

An avian pathogenic Escherichia coli strain M1000 showed a clear zone of
erythrocyte lysis on sheep blood agar plates. The hemolytic activity was not
detected in the culture supernatant nor was any DNA sequence homologous to the
E. coli alpha-hemolysin gene detected in the chromosome or plasmid DNA of the
strain, indicating that the observed hemolysis was different from alpha-type. To
identify the genetic determinant responsible for the hemolysis, we performed
random Tn5 insertional mutagenesis and obtained one mutant, named M5005, that
totally lacked the hemolytic activity. Cloning and nucleotide sequencing of the
region flanking the transposon insertion site in the M5005 chromosome revealed
that the transposon was inserted within an open reading frame of the cyclic AMP
receptor protein (CRP) gene, which is involved in one of the global regulatory
networks of gene expression in E. coli. Nucleotide sequence analysis of the
intact crp gene of the strain M1000 showed that the CRP protein of M1000 is 99%
identical to that of K-12. Introduction of the intact crp gene on a low copy
plasmid into the mutant M5005 restored the hemolytic phenotype, confirming that
the mutation site in M5005 was in the crp gene. CRP plays a central role in
catabolite repression, the phenomenon by which the synthesis of many enzymes
required to metabolize various sugars is repressed in the presence of glucose.
When the hemolytic activity of E. coli M1000 grown in the presence of glucose
was examined, the hemolysis was totally impaired. These results indicate that
the avian pathogenic E. coli strain M1000 produces a hemolysin the expression of
which is dependent on crp gene function.

PMID: 9646453 [PubMed - indexed for MEDLINE]

152: Nucleic Acids Res. 1998 May 1;26(9):2075-81. 

Transcription activation by Escherichia coli FNR protein: similarities to, and
differences from, the CRP paradigm.

Li B, Wing H, Lee D, Wu HC, Busby S.

School of Biochemistry, The University of Birmingham, Birmingham B15 2TT, UK.

During transcription activation at FNR-dependent promoters where the DNA site
for FNR overlaps the -35 element, a surface-exposed activating region in the
upstream subunit of the FNR dimer interacts with the C-terminal domain of the
RNA polymerase alpha subunit. Starting with a cloned fnr gene encoding a
defective FNR derivative carrying substitutions in this activating region, we
screened a library of random mutations to identify substitutions that restored
FNR activity. Activity can be restored by substitutions at residues T118, E47
and K60. The locations of these residues identify three separate surface-exposed
regions of FNR that can play a role in transcription activation. These three
regions appear to be analogues of Activating Region 1, Activating Region 2 and
Activating Region 3 of the cyclic AMP receptor protein, CRP: our results
underscore the similarities between FNR and CRP.

PMID: 9547262 [PubMed - indexed for MEDLINE]

153: EMBO J. 1998 May 15;17(10):2877-85. 

Regulation of crp transcription by oscillation between distinct nucleoprotein
complexes.

Gonzalez-Gil G, Kahmann R, Muskhelishvili G.

Institut fur Genbiologische Forschung Berlin GmbH, Berlin, Germany.
gonzalezgil@neteze.com

FIS belongs to the group of small abundant DNA-binding proteins of Escherichia
coli. We recently demonstrated that, in vivo, FIS regulates the expression of
several genes needed for catabolism of sugars and nucleic acids, a majority of
which are also transcriptionally regulated by cAMP-cAMP-receptor protein (CRP)
complex. Here we provide evidence that FIS represses transcription of the crp
gene both in vivo and in vitro. Employing crp promoter-lacZ fusions, we
demonstrate that both FIS and cAMP-CRP are required to keep the crp promoter in
a repressed state. We have identified in the crp promoter other transcription
initiation sites which are located 73, 79 and 80 bp downstream from the
previously mapped start site. Two CRP- and several FIS-binding sites with
different affinities are located in the crp promoter region, one of them
overlapping the downstream transcription initiation sites. We show that
initiation of transcription at the crp promoter is affected by the composition
of nucleoprotein complexes resulting from the outcome of competition between
proteins for overlapping binding sites. Our results suggest that the control of
crp transcription is achieved by oscillation in the composition of these
regulatory nucleoprotein complexes in response to the physiological state of the
cell.

PMID: 9582281 [PubMed - indexed for MEDLINE]

154: J Bacteriol. 1998 May;180(10):2682-8. 

Negative regulation of IS2 transposition by the cyclic AMP (cAMP)-cAMP receptor
protein complex.

Hu ST, Wang HC, Lei GS, Wang SH.

Department of Microbiology and Graduate Institute of Microbiology and
Immunology, National Yang-Ming University, Taipei, Taiwan, Republic of China.
tingnahu@mailsrv.ym.edu.tw

Three sequences similar to that of the consensus binding sequence of the cyclic
AMP (cAMP)-cAMP receptor protein (CRP) complex were found in the major IS2
promoter region. Experiments were performed to determine whether the cAMP-CRP
complex plays a role in the regulation of IS2 transposition. In the gel
retardation assay, the cAMP-CRP complex was found to be able to bind the major
IS2 promoter. A DNA footprinting assay confirmed that the cAMP-CRP complex binds
to the sequences mentioned above. With an IS2 promoter-luciferase gene fusion
construct, the cAMP-CRP complex was shown to inhibit transcription from the
major IS2 promoter. IS2 was found to transpose at a frequency approximately
200-fold higher in an Escherichia coli host defective for CRP or adenyl cyclase
than in a wild-type host. These results suggest that the cAMP-CRP complex is a
negative regulator of IS2 transposition.

PMID: 9573153 [PubMed - indexed for MEDLINE]

155: J Bacteriol. 1998 May;180(10):2599-608. 

Regulation of the carnitine pathway in Escherichia coli: investigation of the
cai-fix divergent promoter region.

Buchet A, Eichler K, Mandrand-Berthelot MA.

Laboratoire de Genetique Moleculaire des Microorganismes et des Interactions
Cellulaires, CNRS UMR 5577, Institut National des Sciences Appliquees, F-69621
Villeurbanne Cedex, France. lgmm@cismibm.uni-lyon1.fr

The divergent structural operons caiTABCDE and fixABCX of Escherichia coli are
required for anaerobic carnitine metabolism. Transcriptional monocopy lacZ
fusion studies showed that both operons are coexpressed during anaerobic growth
in the presence of carnitine, respond to common environmental stimuli (like
glucose and nitrate), and are modulated positively by the same general
regulators, CRP and FNR, and negatively by H-NS. Overproduction of the CaiF
specific regulatory protein mediating the carnitine signal restored induction in
an fnr mutant, corresponding to its role as the primary target for anaerobiosis.
Transcript analysis identified two divergent transcription start points
initiating 289 bp apart. DNase I footprinting revealed three sites with various
affinities for the binding of the cAMP-CRP complex inside this regulatory
region. Site-directed mutagenesis experiments indicated that previously reported
perfect CRP motif 1, centered at -41.5 of the cai transcriptional start site,
plays a direct role in the sole cai activation. In contrast, mutation in CRP
site 2, positioned at -69.5 of the fix promoter, caused only a threefold
reduction in fix expression. Thus, the role of the third CRP site, located at
-126.5 of fix, might be to reinforce the action of site 2. A critical 50-bp
cis-acting sequence overlapping the fix mRNA start site was found, by deletion
analysis, to be necessary for cai transcription. This region is thought to be
involved in transduction of the signal mediated by the CaiF regulator.

PMID: 9573142 [PubMed - indexed for MEDLINE]

156: Biochemistry. 1998 Apr 14;37(15):5201-10. 

Escherichia coli cAMP receptor protein-DNA complexes. 2. Structural asymmetry of
DNA bending.

Pyles EA, Lee JC.

Department of Human Biological Chemistry and Genetics, The University of Texas
Medical Branch, Galveston, Texas 77555-1055, USA.

The effect of DNA sequence variability and the degree of cyclic AMP receptor
protein (CRP)-induced bending of the flanking ends of fluorescently labeled DNA
were investigated by steady-state fluorescence and differential phase
polarization studies in the presence and absence of CRP. Six sequences,
including the primary CRP binding sites of lac P1 (class I) and gal P1 (class
II), were studied. Excitation and emission spectra of CPM-DNA upon binding CRP
were observed to be qualitatively similar to one another, regardless of the CRP
binding site sequence examined or the location of the probe. This result implies
that the probe is not interacting with the protein. However, the magnitude of
the changes in the fluorescence intensities of sensitized emission spectra of
CPM-DNA is apparently dependent on the DNA sequence, indicating that the
environments of the flanking ends of DNA may be different from one another in
the protein-DNA complex. Differential phase polarization results were
qualitatively consistent with the fluorescence energy transfer measurements. The
implication of this study supports the idea that the DNA is bent symmetrically
in the lac-CRP complex but is asymmetrically bent in the gal-CRP complex. The
sequence in the half-site in conjunction with the flanking sequence defines the
geometry of the bent DNA. It appears that the CRP-induced bend in the DNA may
also be class dependent. This may be an important feature used by the system to
regulate transcription at different promoter sites.

PMID: 9548751 [PubMed - indexed for MEDLINE]

157: Biochemistry. 1998 Apr 14;37(15):5194-200. 

Escherichia coli cAMP receptor protein-DNA complexes. 1. Energetic contributions
of half-sites and flanking sequences in DNA recognition.

Pyles EA, Chin AJ, Lee JC.

Department of Human Biological Chemistry and Genetics, The University of Texas
Medical Branch, Galveston, Texas 77555-1055, USA.

In Escherichia coli, the cyclic AMP receptor protein (CRP) serves as a sensor of
the intracellular level of cyclic AMP. At increasing concentrations of cyclic
AMP, CRP becomes activated upon binding a cyclic AMP molecule. The activated CRP
is capable of regulating the expression of more than 20 genes by binding to
specific DNA sites. The specific DNA sequences recognized by CRP consist of
two-half-sites of the consensus sequence TGTGA......XCAXA. At present, the
relative contributions of the two half-site and flanking sequences in the
energetics of CRP recognition have not been quantitatively defined. A series of
20 DNA sequences was designed to dissect the contributions of individual
half-sites and flanking sequences using the natural gal P1 and lac P1 sequences
as the initial targets. The binding of CRP to these DNA sequences was monitored
by fluorescence anisotropy. None of the individual half-sites or flanking
sequences contributes more to the binding energetics than a random sequence. In
the lac P1 sequence, the combination of both half-sites leads to a >100-fold
increase in affinity compared to that of an individual half-site in CRP-DNA
complex formation. The flanking sequence of lac P1 exhibits a 10- and 0-fold
enhancement in affinity for CRP compared to that of a random sequence in the
presence and absence of the two half-sites, respectively. The observations of
the gal P1 sequence differ from those of the lac P1 sequence. The combination of
both half-sites exhibits no significant increase in affinity, but the flanking
sequence exhibits a 100-fold enhancement in the presence of the two half-sites.
However, there is a disproportionate contribution from the flanking sequence
proximal to the conserved TGTGA motif. The total energetics of the gal-CRP
complex formation is essentially due to the presence of the conserved half-site
and its adjacent flanking sequence. Thus, the relative contributions of the
half-site and flanking sequences to the energetics of DNA recognition are operon
specific.

PMID: 9548750 [PubMed - indexed for MEDLINE]

158: J Bacteriol. 1998 Apr;180(7):1777-85. 

Positive and negative transcriptional regulation of the Escherichia coli
gluconate regulon gene gntT by GntR and the cyclic AMP (cAMP)-cAMP receptor
protein complex.

Peekhaus N, Conway T.

Department of Microbiology, The Ohio State University, Columbus 43210-1292, USA.
peekhaus.1@osu.edu

The gntT gene of Escherichia coli is specifically induced by gluconate and
repressed via catabolite repression. Thus, gluconate is both an inducer and a
repressor of gntT expression since gluconate is a catabolite-repressing sugar.
In a gntR deletion mutant, the expression of a chromosomal gntT::lacZ fusion is
both high and constitutive, confirming that GntR is the negative regulator of
gntT. Indeed, GntR binds to two consensus gnt operator sites; one overlaps the
-10 region of the gntT promoter, and the other is centered at +120 with respect
to the transcriptional start site. The binding of GntR to these sites was proven
in vitro by gel redardation assays and in vivo by site-directed mutagenesis of
the binding sites. Binding of GntR to the operators is eliminated by gluconate
and also by 6-phosphogluconate at a 10-fold-higher concentration. Interestingly,
when gntR deletion strains are grown in the presence of gluconate, there is a
twofold decrease in gntT expression which is independent of catabolite
repression and binding of GntR to the operator sites. This novel response of
gntR mutants to the inducer is termed ultrarepression. Transcription of gntT is
activated by binding of the cyclic AMP (cAMP)-cAMP receptor protein (CRP)
complex to a CRP binding site positioned at -71 upstream of the gntT
transcription start site.

PMID: 9537375 [PubMed - indexed for MEDLINE]

159: Microbiology. 1998 Mar;144 ( Pt 3):705-17. 

A novel regulatory switch mediated by the FNR-like protein of Lactobacillus
casei.

Gostick DO, Green J, Irvine AS, Gasson MJ, Guest JR.

Krebs Institute for Biomolecular Research, Department of Molecular Biology and
Biotechnology, University of Sheffield, Western Bank, UK.

FNR (regulator for fumarate and nitrate reduction) and CRP (cAMP receptor
protein) are global regulators which regulate the transcription of overlapping
modulons of target genes in response to anaerobiosis and carbon source in
Escherichia coli. An ORF, designated flp because it encodes an FNR-like protein
of the FNR-CRP family, has been found in Lactobacillus casei. The product of the
flp coding region (FLP) was overproduced in E. coli, purified and crystallized.
FLP is a homodimeric protein in which each subunit can form an intramolecular
disulphide bond. The isolated protein also contains non-stoichiometric amounts
of Cu and Zn. Although the DNA recognition helix of FLP resembles that of FNR,
the flp gene failed to complement the anaerobic respiratory deficiency of an fnr
mutant when expressed in E. coli and it neither activated nor interfered with
transcription from FNR- or CRP-dependent promoters in E. coli. Site-specific DNA
binding by oxidized FLP (the form containing intrasubunit disulphide bonds) was
abolished by reduction. The interconversion between disulphide and dithiol forms
thus provides the basis for a novel redox-mediated transcriptional switch. Two
non-identical FLP-binding sites, distinct from FNR- and CRP-binding sites, were
identified in the meIR region of E. coli by gel-retardation analysis. A further
eight FLP-binding sites were selected from a random library. A synthetic
oligonucleotide conforming to a putative FLP site consensus, CA/CTGA-N4-TCAG/TG
(the most significant bases are underlined), was retarded by FLP. Functional
tests showed that FLP represses the aerobic transcription of a semi-synthetic
promoter in E. coli. A C5S variant of FLP lacking the ability to form
intramolecular disulphide bonds was unable to bind to FLP sites and failed to
repress transcription in vivo.

PMID: 9534240 [PubMed - indexed for MEDLINE]

160: Biochem J. 1998 Feb 15;330 ( Pt 1):413-20. 

Spacing requirements for interactions between the C-terminal domain of the alpha
subunit of Escherichia coli RNA polymerase and the cAMP receptor protein.

Lloyd GS, Busby SJ, Savery NJ.

School of Biochemistry, University of Birmingham, Edgbaston, Birmingham B15 2TT,
U.K.

During transcription initiation at bacterial promoters, the C-terminal domain of
the RNA polymerase alpha subunit (alphaCTD) can interact with DNA-sequence
elements (known as UP elements) and with activator proteins. We have constructed
a series of semi-synthetic promoters carrying both an UP element and a consensus
DNA-binding site for the Escherichia coli cAMP receptor protein (CRP; a factor
that activates transcription by making direct contacts with alphaCTD). At these
promoters, the UP element was located at a variety of distances upstream of the
CRP-binding site, which was fixed at position -41.5 bp upstream of the
transcript start. At some positions, the UP element caused enhanced promoter
activity whereas, at other positions, it had very little effect. In no case was
the CRP-dependence of the promoter relieved. DNase I and hydroxyl-radical
footprinting were used to study ternary RNA polymerase-CRP-promoter complexes
formed at two of the most active of these promoters, and co-operativity between
the binding of CRP and purified alpha subunits was studied. The footprints show
that alphaCTD binds to the UP element as it is displaced upstream but that this
displacement does not prevent alphaCTD from being contacted by CRP. Models to
account for this are discussed.

PMID: 9461538 [PubMed - indexed for MEDLINE]

161: Biochim Biophys Acta. 1998 Mar 4;1396(1):114-26. 

Multiple promoters are responsible for transcription of the glpEGR operon of
Escherichia coli K-12.

Yang B, Larson TJ.

Department of Biochemistry, Virginia Polytechnic Institute and State University,
Blacksburg 24061-0308, USA.

The transcriptional organization of the glpEGR genes of Escherichia coli was
studied. Besides a promoter located upstream of the glpE start codon, three
internal glpGR promoters were identified that express glpG and/or glpR (glp
repressor). One promoter was located just upstream of the glpG start codon and
two others (separated by several hundred base pairs) were located within glpG
upstream of the glpR start codon. The transcriptional start points of these
promoters were identified by primer extension analysis. The strengths of the
individual promoters were compared by analysis of their expression when fused to
a pormoter-probe vector. Analysis of the transcriptional expression of the
glpEGR sequence with different combinations of the glpEGR promoters revealed no
internal transcriptional terminators within the entire operon. Thus, the glpEGR
genes are co-transcribed and form a single complex operon. The presence of
multiple promoters may provide for differential expression of glpE, glpG and
glpR. Potential regulation of the operon promoters by GlpR, catabolite
repression, anaerobiosis or by FIS was studied. The glpE promoter was apparently
controlled by the cAMP-CRP complex, but none of the promoters was responsive to
specific repression by GlpR, to anaerobiosis or to FIS. Specific repression
exerted by GlpR was characterized in vivo using glpD-lacZ and glpK-lacZ fusions.
The degree of repression was correlated with the level of GlpR expression, and
was inefficient when the glpD-encoded glycerol-P dehydrogenase was absent,
presumably due to accumulation of the inducer, glycerol-P. This is in contrast
to the previous conclusion that gpsA-encoded glycerol-P synthase tightly
controls the cellular level of glycerol-P by end product inhibition.

PMID: 9524241 [PubMed - indexed for MEDLINE]

162: J Mol Biol. 1998 Feb 20;276(2):339-53. 

Molecular analysis of the regulation of csiD, a carbon starvation-inducible gene
in Escherichia coli that is exclusively dependent on sigma s and requires
activation by cAMP-CRP.

Marschall C, Labrousse V, Kreimer M, Weichart D, Kolb A, Hengge-Aronis R.

Department of Biology, University of Konstanz, Germany.

The general stress-induced sigma subunit sigma s of Escherichia coli RNA
polymerase is closely related to the vegetative sigma factor sigma 70. In view
of their very similar promoter specificity in vitro, it is unclear how sigma
factor selectivity in the expression of sigma s-dependent genes is generated in
vivo. The csiD gene is such a strongly sigma s-dependent gene. In contrast to
sigma s, which is induced in response to many different stresses, csiD, whose
expression is driven from a single promoter, is induced by carbon starvation
only. To our knowledge, the csiD promoter is the first characterized promoter
which is not only exclusively dependent on sigma s-containing RNA polymerase (E
sigma s), but also requires an activator, cAMP-CRP. In addition,
leucine-responsive regulatory protein (Lrp) acts as a positive modulator of csiD
expression. Also in vitro, E sigma s is more efficient than E sigma 70 in csiD
promoter binding, open complex formation and run-off transcription, which might
be due to the poor match of the csiD -35 region to the sigma 70 consensus and to
transcription by E sigma s being less dependent on contacts in this region. By
DNase I protection experiments, a cAMP-CRP binding site centered at -68.5
nucleotides upstream of the csiD transcriptional start site was identified.
While cAMP-CRP stimulates E sigma 70 binding, it does not promote open complex
formation by E sigma 70, but does so in conjunction with E sigma s. With linear
templates, cAMP-CRP significantly stimulates E sigma s-mediated in vitro
transcription, whereas transcription by E sigma 70 is negligible and hardly
stimulated by cAMP-CRP. These findings may reflect different or less stringent
positional requirements for an activator site for E sigma s than for E sigma 70,
and indicate that cAMP-CRP contributes to sigma factor selectivity at the csiD
promoter. In vitro transcription experiments with super-coiled templates,
however, revealed significant cAMP-CRP-stimulated transcription also by E sigma
70. Yet, under these conditions, H-NS was found to restore E sigma s specificity
by strongly interfering with cAMP-CRP/E sigma 70-dependent transcription. Lrp
strongly and cooperatively binds to multiple sites located between positions -14
and -102 (in a way that suggests DNA wrapping around multiple Lrp molecules) and
moderately stimulates in vitro transcription, especially with E sigma s. In
summary, we conclude that the csiD promoter has an intrinsic preference for E
sigma s, but that also protein factors such as cAMP-CRP, Lrp and probably H-NS
as well as DNA conformation contribute to its strong E sigma s selectivity.
Furthermore, this strong E sigma s preference in combination with a requirement
for high concentrations of the essential activator cAMP-CRP ensures csiD
expression under conditions of carbon starvation, but not other stress
conditions.

PMID: 9512707 [PubMed - indexed for MEDLINE]

163: Mol Microbiol. 1998 Jan;27(1):41-50. 

DNA-binding characteristics of the Escherichia coli CytR regulator: a relaxed
spacing requirement between operator half-sites is provided by a flexible,
unstructured interdomain linker.

Jorgensen CI, Kallipolitis BH, Valentin-Hansen P.

Department of Molecular Biology, Odense University, Odense M, Denmark.

The Escherichia coli CytR regulator belongs to the LacI family of
sequence-specific DNA-binding proteins and prevents CRP-mediated transcription
in the CytR regulon. Unlike the other members of this protein family, CytR binds
with only modest affinity to its operators and transcription repression thus
relies on the formation of nucleoprotein complexes with the cAMP-CRP complex.
Moreover, CytR exhibits a rotational and translational flexibility in operator
binding that is unprecedented in the LacI family. In this report we examined the
effect of changing the spacing between CytR half-operators on CytR regulation in
vivo and on CytR binding in vitro. Maximum repression was seen with the short
spacing variants: repression peaks when the half-operators lie on the same face
of the DNA helix. Repression was retained for most spacing variants with centre
separations of half-operators < or = 3 helical turns. Our data confirm and
extend the view that CytR is a highly flexible DNA binder that can adapt many
different conformations for co-operative binding with CRP. Furthermore, limited
proteolysis of radiolabelled CytR protein showed that the interdomain linker
connecting the DNA binding domains and the core part of CytR does not become
structured upon DNA binding. We conclude that CytR does not use hinge
alpha-helices for minor groove recognition. Rather, CytR possesses a highly
flexible interdomain linker that allows it to form complexes with CRP at
promoters with quite different architecture.

PMID: 9466254 [PubMed - indexed for MEDLINE]

164: Infect Immun. 1998 Jan;66(1):224-31. 

Levels of expression and immunogenicity of attenuated Salmonella enterica
serovar typhimurium strains expressing Escherichia coli mutant heat-labile
enterotoxin.

Covone MG, Brocchi M, Palla E, Dias da Silveira W, Rappuoli R, Galeotti CL.

Immunobiology Research Institute Siena, Department of Molecular Biology, Chiron
Vaccines, Italy.

The effects of heterologous gene dosage as well as Salmonella typhimurium strain
variability on immune response toward both the heterologous antigen, the
nontoxic mutant of the Escherichia coli heat-labile enterotoxin LTK63, and the
carrier Salmonella strain have been analyzed. Effects of a single integration
into the host DNA and different-copy-number episomal vectors were compared in S.
typhimurium delta cya delta crp delta asd strains of two different serotypes,
UK-1 and SR-11. Expression of the enterotoxin in the different Salmonella
isolates in vitro was found to vary considerably and, for the episomal vectors,
to correlate with the plasmid copy number. LTK63-specific serum immunoglobulin G
(IgG) and mucosal immunoglobulin A (IgA) antibodies were highest in mice
immunized with the high-level-expression strain. High anti-LTK63 IgG and IgA
titers were found to correspond to higher anti-Salmonella immunity, suggesting
that LTK63 exerts an adjuvant effect on response to the carrier. Statistically
significant differences in anti-LTK63 immune response were observed between
groups of mice immunized with the attenuated delta cya delta crp UK-1 and SR-11
derivatives producing the antigen at the same rate. These data indicate that the
same attenuation in S. typhimurium strains of different genetic backgrounds can
influence significantly the immune response toward the heterologous antigen.
Moreover, delivery of the LTK63 enterotoxin to the immune system by attenuated
S. typhimurium strains is effective only when synthesis of the antigen is very
high during the initial phase of invasion, while persistence of the S.
typhimurium strain in deep tissues has only marginal influence.

PMID: 9423862 [PubMed - indexed for MEDLINE]

165: Microbiology. 1997 Dec;143 ( Pt 12):3795-805. 

Transcriptional regulation of the aconitase genes (acnA and acnB) of Escherichia
coli.

Cunningham L, Gruer MJ, Guest JR.

Krebs Institute for Biomolecular Research, Department of Molecular Biology and
Biotechnology, University of Sheffield, UK.

Escherichia coli contains two differentially regulated aconitase genes, acnA and
acnB. Two acnA promoters transcribing from start points located 407 bp (P1acnA)
and 50 bp (P2acnA) upstream of the acnA coding region, and one acnB promoter
(PacnB) with a start point 95 bp upstream of the acnB coding region, were
identified by primer extension analysis. A 2.8 kb acnA monocistronic transcript
was detected by Northern blot hybridization, but only in redox-stressed
(methyl-viologen-treated) cultures, and a 2.5 kb acnB monocistronic transcript
was detected in exponential- but not stationary-phase cultures. These findings
are consistent with previous observations that acnA is specifically subject to
SoxRS-mediated activation, whereas acnB encodes the major aconitase that is
synthesized earlier in the growth cycle than AcnA. Further studies with acn-lacZ
gene fusions and a wider range of transcription regulators indicated that acnA
expression is initiated by sigma 38 from P1acnA, and from P2acnA it is activated
directly or indirectly by CRP, FruR, Fur and SoxRS, and repressed by ArcA and
FNR. In contrast, acnB expression is activated by CRP and repressed by ArcA,
FruR and Fis from PacnB. Comparable studies with fum-lacZ fusions indicated that
transcription of fumC, but not of fumA or fumB, is initiated by RNA polymerase
containing sigma 38. It is concluded that AcnB is the major citric acid cycle
enzyme, whereas AcnA is an aerobic stationary-phase enzyme that is specifically
induced by iron and redox-stress.

PMID: 9421904 [PubMed - indexed for MEDLINE]

166: FEMS Microbiol Lett. 1997 Dec 1;157(1):59-65. 

Characterization of a periplasmic peptidyl-prolyl cis-trans isomerase in Erwinia
chrysanthemi.

Pissavin C, Hugouvieux-Cotte-Pattat N.

Laboratoire de Genetique Moleculaire des Microorganismes et des Interactions
Cellulaires, CNRS-UMR 5577, INSA de Lyon, Villeurbanne, France.
Igmm@cismibm.univ-lyon1.fr

The main determinant of the plant pathogen Erwinia chrysanthemi virulence is the
production of extracellular enzymes, mainly pectate lyases. Adjacent to a
pectate lyase encoding locus, we identified the gene rotA supposed to encode a
folding catalyst. Overproduction of the protein and assay of activity using a
synthetic substrate, confirmed that rotA encodes a periplasmic peptidyl-prolyl
cis-trans isomerase. rotA disruption provokes no change in cell morphology, cell
viability, growth rate or stability of the extracellular and periplasmic
proteins. In addition, this mutation does not alter the activity of the pectate
lyases, their stability in the periplasm during the transitory step of secretion
or their recognition by the Out secretory system. rotA expression was followed
using a rotA::uidA transcriptional fusion. Some environmental conditions, such
as temperature variations and nitrogen starvation, modulate rotA expression. In
contrast to the E. coli rotA gene, the E. chrysanthemi rotA possesses only one
promoter and is not controlled by the CRP global regulator.

PMID: 9418240 [PubMed - indexed for MEDLINE]

167: Proc Natl Acad Sci U S A. 1997 Nov 25;94(24):12914-9. 

cAMP receptor protein-cAMP plays a crucial role in glucose-lactose diauxie by
activating the major glucose transporter gene in Escherichia coli.

Kimata K, Takahashi H, Inada T, Postma P, Aiba H.

Department of Molecular Biology, School of Science, Nagoya University, Chikusa,
Japan.

The inhibition of beta-galactosidase expression in a medium containing both
glucose and lactose is a typical example of the glucose effect in Escherichia
coli. We studied the glucose effect in the lacL8UV5 promoter mutant, which is
independent of cAMP and cAMP receptor protein (CRP). A strong inhibition of
beta-galactosidase expression by glucose and a diauxic growth were observed when
the lacL8UV5 cells were grown on a glucose-lactose medium. The addition of
isopropyl beta-D-thiogalactoside to the culture medium eliminated the glucose
effect. Disruption of the crr gene or overproduction of LacY also eliminated the
glucose effect. These results are fully consistent with our previous finding
that the glucose effect in wild-type cells growing in a glucose-lactose medium
is not due to the reduction of CRP-cAMP levels but is due to the inducer
exclusion. We found that the glucose effect in the lacL8UV5 cells was no longer
observed when either the crp or the cya gene was disrupted. Evidence suggested
that CRP-cAMP may not enhance directly the lac repressor action in vivo.
Northern blot analysis revealed that the mRNA for ptsG, a major glucose
transporter gene, was markedly reduced in a delta crp or delta cya background.
The constitutive expression of the ptsG gene by the introduction of a multicopy
plasmid restored the glucose effect in delta cya or delta crp cells. We conclude
that CRP-cAMP plays a crucial role in inducer exclusion, which is responsible
for the glucose-lactose diauxie, by activating the expression of the ptsG gene.

PMID: 9371775 [PubMed - indexed for MEDLINE]

168: Gene. 1997 Oct 1;198(1-2):297-303. 

Sequence and functional analysis of the gene encoding Vibrio cholerae cAMP
receptor protein.

Skorupski K, Taylor RK.

Dartmouth Medical School, Department of Microbiology, Hanover, NH 03755, USA.
karen.skorupski@dartmouth.edu

We describe here the cloning, nucleotide sequence, and functional expression of
the crp gene of Vibrio cholerae (Vc) encoding the cyclic AMP receptor protein
(CRP). The Vc crp gene shows 81% identity with the crp gene from Escherichia
coli (Ec) and its deduced amino acid sequence shows 95% identity with the Ec
protein. When expressed from inducible promoters, the cloned Vc gene produced an
approximately 20-kDa protein which complemented the carbohydrate-negative and
growth-defective phenotypes of both Ec and Vc crp mutants. In the Vc crp mutant,
the cloned crp gene also restored the normal repression of ToxR-regulated
virulence genes which occurs under certain environmental conditions.

PMID: 9370295 [PubMed - indexed for MEDLINE]

169: Gene. 1997 Oct 15;199(1-2):203-10. 

Characterization of the gntT gene encoding a high-affinity gluconate permease in
Escherichia coli.

Izu H, Kawai T, Yamada Y, Aoshima H, Adachi O, Yamada M.

Department of Biological Chemistry, Faculty of Agriculture, Yamaguchi
University, Japan.

We characterized the gntT gene encoding a high-affinity gluconate permease of
Escherichia coli K-12. Primer extension and lacZ-operon fusion analyses revealed
that gntT has one strong and two weak promoters, all of which are regulated
positively by cAMP-CRP and negatively by GntR. The weak promoters became
constitutive when separated from the upstream region including the strong
promoter that overlaps a putative GntR-binding sequence. Gluconate-specific
uptake activity was observed with cells harboring the gntT plasmid clone, which
was enhanced by the presence of gntK encoding gluconate kinase.

PMID: 9358057 [PubMed - indexed for MEDLINE]

170: Mol Microbiol. 1997 Sep;25(6):1141-8. 

Cascade regulation of the two CRP/FNR-related transcriptional regulators (ANR
and DNR) and the denitrification enzymes in Pseudomonas aeruginosa.

Arai H, Kodama T, Igarashi Y.

The Institute of Physical and Chemical Research (RIKEN), Saitama, Japan.

ANR, an analogue of Escherichia coli FNR, has been shown to be necessary for
denitrification, arginine deiminase activity and cyanide production of
Pseudomonas aeruginosa. Another CRP/FNR-related regulator, DNR, has also been
shown to be necessary for denitrification. In this study, we have found that the
transcription of the dnr gene is under the control of ANR. When the dnr gene was
expressed by tac promoter in an anr mutant, the strain recovered the ability to
grow under anaerobic conditions by denitrification. Nitrate, nitrite, nitric
oxide and nitrous oxide reducing activities were expressed, and the structural
genes for nitrite and nitric oxide reductases were transcribed under anaerobic
conditions in the anr mutant strain transformed with the dnr gene. These
findings suggest that the expression of the denitrification system is controlled
not directly by ANR but indirectly via DNR. The arginine deiminase activity and
cyanide production were not regulated by DNR.

PMID: 9350869 [PubMed - indexed for MEDLINE]

171: J Bacteriol. 1997 Oct;179(19):6181-6. 

Transcriptional regulation of the Escherichia coli oxyR gene as a function of
cell growth.

Gonzalez-Flecha B, Demple B.

Department of Molecular and Cellular Toxicology, Harvard School of Public
Health, Boston, Massachusetts 02115, USA.

The oxyR regulon plays a central role in the defense of Escherichia coli against
the endogenous oxidative damage associated with active aerobic growth. Here we
have studied the transcriptional regulation of oxyR in E. coli growing
aerobically in rich medium. Expression of a single-copy oxyR'::lacZ reporter
construct varied sixfold along the growth curve, with the highest value at 4 to
6 h of growth (approximately 14 x 10(8) cells x ml(-1)). Direct measurements of
oxyR mRNA by primer extension showed the same biphasic expression but with a
peak somewhat earlier in cell growth (2 to 3 h; approximately 3.5 x 10(8) cells
x ml(-1)). The results of immunoblotting experiments demonstrated that the level
of OxyR protein exhibits the same biphasic expression. Mutant strains lacking
adenylate cyclase (cya) or Crp protein (crp) failed to increase oxyR expression
during exponential growth. On the other hand, an rpoS mutation allowed oxyR
expression to continue increasing as the cells entered stationary phase.
Consistent with a biological role for increased levels of OxyR during
exponential growth, the crp cya strain had lower activities of catalase
hydroperoxidase I and glutathione reductase and an increased sensitivity to
exogenously added hydrogen peroxide. These results suggest that the
Crp-dependent upregulation of oxyR in exponential phase is a component of a
multistep strategy to counteract endogenous oxidative stress in actively growing
E. coli cells.

PMID: 9324269 [PubMed - indexed for MEDLINE]

172: Proc Natl Acad Sci U S A. 1997 Oct 14;94(21):11274-8. 

Positioning of two alpha subunit carboxy-terminal domains of RNA polymerase at
promoters by two transcription factors.

Murakami K, Owens JT, Belyaeva TA, Meares CF, Busby SJ, Ishihama A.

Department of Molecular Genetics, National Institute of Genetics, Mishima,
Shizuoka 411, Japan.

Interactions between the cAMP receptor protein (CRP) and the carboxy-terminal
regulatory domain (CTD) of Escherichia coli RNA polymerase alpha subunit were
analyzed at promoters carrying tandem DNA sites for CRP binding using a chemical
nuclease covalently attached to alpha. Each CRP dimer was found to direct the
positioning of one of the two alpha subunit CTDs. Thus, the function of RNA
polymerase may be subject to regulation through protein-protein interactions
between the two alpha subunits and two different species of transcription
factors.

PMID: 9326599 [PubMed - indexed for MEDLINE]

173: Mol Microbiol. 1997 Aug;25(4):797-809. 

Differential regulation of fasA and fasH expression of Escherichia coli 987P
fimbriae by environmental cues.

Edwards RA, Schifferli DM.

Department of Pathobiology, University of Pennsylvania School of Veterinary
Medicine, Philadelphia 19104, USA.

An early process in the pathogenesis of enteric bacteria is colonization of the
intestinal epithelium leading to local multiplication, pathophysiological
interactions with the host and further spreading. Attachment is typically
mediated by bacterial fimbriae, which are selectively expressed during growth in
the intestine. Here we report an analysis of the regulation of 987P fimbrial
expression of enterotoxigenic Escherichia coli (ETEC). Expression of both fasH,
the transcriptional activator of the 987P fimbrial genes, and fasA, the major
fimbrial subunit, is regulated in response to a variety of environmental
stimuli. We have found that expression of fasH is regulated in response to the
carbon status of the growth medium by the cAMP-CRP complex. Moreover, fasH is
regulated in response to both the nitrogen status of the growth medium and the
external pH. Expression of fasA is activated by FasH, and is also selectively
regulated in response to growth temperature by HNS. Regulation of fimbrial
expression by carbon and/or nitrogen gradients is proposed to provide a
mechanism that allows preferential colonization of different segments of the
intestine by various enteropathogens, such as ETEC, enteropathogenic E. coli and
Vibrio cholerae.

PMID: 9379907 [PubMed - indexed for MEDLINE]

174: J Bacteriol. 1997 Aug;179(15):4874-81. 

Osmoprotectant-dependent expression of plcH, encoding the hemolytic
phospholipase C, is subject to novel catabolite repression control in
Pseudomonas aeruginosa PAO1.

Sage AE, Vasil ML.

Department of Microbiology, University of Colorado Health Sciences Center,
Denver 80262, USA.

Expression of the hemolytic phospholipase C (PlcH) of Pseudomonas aeruginosa is
induced under phosphate starvation conditions or in the presence of the
osmoprotectants choline and glycine betaine. Because choline and glycine betaine
may serve as carbon and energy sources in addition to conferring osmoprotection
to P. aeruginosa, it seemed possible that induction of plcH is subject to
catabolite repression control (CRC) by tricarboxylic cycle intermediates such as
succinate. Total phospholipase (PLC) activity in osmoprotectant-induced cultures
of P. aeruginosa PAO1 supplemented with 20 mM succinate was three- to fourfold
lower than the levels in cultures supplemented with the
non-catabolite-repressive substrate lactate. Analyses of
osmoprotectant-dependent plcH expression in a derivative of strain PAO1
containing a plcH::lacZ operon fusion showed that (i) succinate prevented
induction of plcH expression by osmoprotectants; and (ii) addition of succinate
reduced or shut down further expression of plcH in osmoprotectant-induced
bacteria, while cultures supplemented with lactate had little or no change in
plcH expression. RNase protection analysis confirmed that repression of plcH
occurs at the transcriptional level. However, a P. aeruginosa mutant decoupled
in CRC exhibited a phenotype similar to that of the wild-type strain (PAO1) with
respect to succinate-dependent repression of plcH expression.
Osmoprotectant-induced total PLC activities, levels of expression of plcH
measured with the same plcH::lacZ fusion, and levels of plcH transcription in a
CRC-deficient strain reflected those seen in strain PAO1. This indicates that
CRC of plcH functions by a distinct mechanism which differs from that regulating
the glucose or mannitol catabolic pathway. A strain carrying a mutation in vfr,
which encodes the Escherichia coli Crp homolog in P. aeruginosa, still exhibited
a wild-type phenotype with respect to osmoprotectant-dependent expression and
CRC of plcH. These data indicate that there is a novel CRC system that regulates
the expression of plcH in P. aeruginosa.

PMID: 9244277 [PubMed - indexed for MEDLINE]

175: J Biol Chem. 1997 Jul 4;272(27):16962-71. 

Allosteric mechanism of induction of CytR-regulated gene expression. Cytr
repressor-cytidine interaction.

Barbier CS, Short SA, Senear DF.

Molecular Sciences, Glaxo Welcome, Research Triangle Park, North Carolina 27709,
USA.

Transcription from cistrons of the Escherichia coli CytR regulon is activated by
E. coli cAMP receptor protein (CRP) and repressed by a multiprotein complex
composed of CRP and CytR. De-repression results when CytR binds cytidine. CytR
is a homodimer and a LacI family member. A central question for all LacI family
proteins concerns the allosteric mechanism that couples ligand binding to the
protein-DNA and protein-protein interactions that regulate transcription. To
explore this mechanism for CytR, we analyzed nucleoside binding in vitro and its
coupling to cooperative CytR binding to operator DNA. Analysis of the
thermodynamic linkage between sequential cytidine binding to dimeric CytR and
cooperative binding of CytR to deoP2 indicates that de-repression results from
just one of the two cytidine binding steps. To test this conclusion in vivo,
CytR mutants that have wild-type repressor function but are cytidine
induction-deficient (CID) were identified. Each has a substitution for Asp281 or
neighboring residue. CID CytR281N was found to bind cytidine with three orders
of magnitude lower affinity than wild-type CytR. Other CytR mutants that do not
exhibit the CID phenotype were found to bind cytidine with affinity similar to
wild-type CytR. The rate of transcription regulated by heterodimeric CytR
composed of one CytR281N and one wild-type subunit was compared with that
regulated by wild-type CytR under inducing conditions. The data support the
conclusion that the first cytidine binding step alone is sufficient to induce.

PMID: 9202008 [PubMed - indexed for MEDLINE]

176: Gene. 1997 Jun 11;192(1):63-70. 

The tcp gene cluster of Vibrio cholerae.

Manning PA.

Department of Microbiology and Immunology, University of Adelaide, Australia.
pmanning@microb.adelaide.edu.au

The toxin co-regulated pilus (TCP) has been identified as a critical
colonization factor in both animal models and humans for Vibrio cholerae O1. The
major pilin subunit, TcpA (and also TcpB), is similar to type-4 pilins but TCP
probably more appropriately belongs to a sub-class which includes the
bundle-forming pilus of enteropathogenic Escherichia coli. The genes for TCP
biosynthesis and assembly are clustered with the exception of housekeeping
functions such as TcpG (=DsbA, a periplasmic disulfide bond epimerase). The nt
sequences from El Tor and classical strains show only minor differences
corresponding to the major regulatory regions and in TcpA itself. These
differences are thought to account for the alternate conditions required for
expression of TCP by the two biotypes and the antigenic variation and lack of
cross-protection. Aside from the TcpA only a few of the proteins have had their
roles in TCP biogenesis defined. Regulation of TCP is controlled by the ToxR
regulon via ToxT with a possible involvement of TcpP and the cAMP-CRP system.
Experiments using the infant mouse cholera model have now shown that TCP is a
colonization factor and protective antigen for both classical and El Tor O1
strains and in the O139 Bengal serotype and that the mannose-sensitive
haemagglutinin pilus does not appear to play a comparable role.

PMID: 9224875 [PubMed - indexed for MEDLINE]

177: Microbiology. 1997 Jun;143 ( Pt 6):2085-95. 

The aldA gene of Escherichia coli is under the control of at least three
transcriptional regulators.

Limon A, Hidalgo E, Aguilar J.

Department of Biochemistry, Faculty of Pharmacy, University of Barcelona, Spain.

Expression studies on the aldA gene encoding aldehyde dehydrogenase in
Escherichia coli showed induction by two types of molecule (hydroxyaldehydes and
2-oxoglutarate), carbon catabolite repression and respiration dependence.
Promoter deletion analysis showed that the proximal operator, which includes
inducer-regulator complex and catabolite repression protein (Crp) recognition
sites, was necessary for induction by either type of inducer, and that full
induction by aldehydes required the cooperation of distal operator sequences
beyond position -119. Interactions of the regulator protein with the -59 to -6
fragment were shown by DNA mobility shift assays. Fusions of different deletions
of the aldA promoter to lacZ indicated that a Crp site proximal to the
transcriptional start point (tsp) was functional in the cAMP-dependent
catabolite repression of this system, whereas a distal control site was likely
to operate in a cAMP-independent catabolite repression. DNA mobility shift and
footprint analyses showed that only the tsp proximal site was bound by pure Crp
with a Kd of 5.4 x 10(-7) M. As shown by an Arc-defective strain, the aldA gene
seems to be repressed by the Arc system under anaerobiosis, displaying its
physiological full induction and activity in the presence of oxygen.

PMID: 9202484 [PubMed - indexed for MEDLINE]

178: FEMS Microbiol Lett. 1997 Jun 1;151(1):9-16. 

Identification of the pac promoter from Kluyvera citrophila.

Roa A, Garcia JL.

Department of Molecular Microbiology, Consejo Superior de Investigaciones
Cientificas, Madrid, Spain.

The nucleotide sequence of the 5'-terminal region of the pac gene encoding the
penicillin G acylase from Kluyvera citrophila ATCC 21285 has been determined.
The transcriptional start site has been identified by primer extension analysis
in a different position to that previously found for the homologous pac gene of
Escherichia coli W ATCC 11105. Two nucleotide changes in the -35 box appear to
be responsible of the promoter displacement in K. citrophila. A putative
upstream promoter element (A+T-rich enhancer sequence) and a binding site for
the cAMP receptor protein (CRP) were located upstream of the -35 box.
Transcriptional lacZ and cat fusions demonstrated that pac expression was
subjected to catabolite repression mediated by cAMP and its receptor protein.
Remarkably, phenylacetic acid which is a potent inducer of the penicillin G
acylase from E. coli, was only able to cause a significant induction of the pac
expression in CRP+ cells cultured in the presence of glucose, suggesting that
this effect is CRP-dependent.

PMID: 9198278 [PubMed - indexed for MEDLINE]

179: J Bacteriol. 1997 Jun;179(12):3928-35. 

Vfr controls quorum sensing in Pseudomonas aeruginosa.

Albus AM, Pesci EC, Runyen-Janecky LJ, West SE, Iglewski BH.

Department of Microbiology and Immunology, University of Rochester School of
Medicine and Dentistry, New York 14642, USA.

Pseudomonas aeruginosa controls several genes in a cell density-dependent manner
through a phenomenon termed quorum sensing. The transcriptional activator
protein of the las quorum-sensing system is encoded for by the lasR gene, which
is at the top of a quorum-sensing hierarchy. The activation of LasR as a
transcriptional activator induces the expression of multiple genes that code for
factors important for virulence, and rhlR, which encodes the transcriptional
activator protein of the P. aeruginosa rhl quorum-sensing system. Elucidating
the method of lasR regulation is crucial to understanding P. aeruginosa quorum
sensing. In this report, we present studies on the transcriptional control of
lasR. We identified two distinct transcriptional start sites for lasR that were
located 201 bp (transcript T1) and 231 bp (transcript T2) upstream from the lasR
start of translation. With the use of transcriptional lasRp-lacZ fusions, we
showed that in P. aeruginosa, lasR expression is cell density dependent. This
gene was expressed at a basal level until it was induced during the second half
of log-phase growth, with expression becoming maximal during stationary-phase
growth. We also showed that lasR expression was regulated through the cyclic AMP
receptor protein (CRP)-binding consensus sequence in its promoter region. Our
results from P. aeruginosa mutant studies and gel retardation assays indicated
that this regulation was mediated by Vfr, a homolog of the Escherichia coli CRP.

PMID: 9190808 [PubMed - indexed for MEDLINE]

180: J Bacteriol. 1997 Jun;179(11):3500-8. 

The cyclic AMP receptor protein is the main activator of pectinolysis genes in
Erwinia chrysanthemi.

Reverchon S, Expert D, Robert-Baudouy J, Nasser W.

Laboratoire de Genetique Moleculaire des Microorganismes et des Interactions
Cellulaires, CNRS UMR 5577, INSA Bat 406, Villeurbanne, France.

The main virulence factors of the phytopathogenic bacterium Erwinia chrysanthemi
are pectinases that cleave pectin, a major constituent of the plant cell wall.
Although physiological studies suggested that pectinase production in Erwinia
species is subjected to catabolite repression, the direct implication of the
cyclic AMP receptor protein (CRP) in this regulation has never been
demonstrated. To investigate the role of CRP in pectin catabolism, we cloned the
E. chrysanthemi crp gene by complementation of an Escherichia coli crp mutation
and then constructed E. chrysanthemi crp mutants by reverse genetics. The
carbohydrate fermentation phenotype of the E. chrysanthemi crp mutants is
similar to that of an E. coli crp mutant. Furthermore, these mutants are unable
to grow on pectin or polygalacturonate as the sole carbon source. Analysis of
the nucleotide sequence of the E. chrysanthemi crp gene revealed the presence of
a 630-bp open reading frame (ORF) that codes for a protein highly similar to the
CRP of E. coli. Using a crp::uidA transcriptional fusion, we demonstrated that
the E. chrysanthemi CRP represses its own expression, probably via a mechanism
similar to that described for the E. coli crp gene. Moreover, in the E.
chrysanthemi crp mutants, expression of pectinase genes (pemA, pelB, pelC, pelD,
and pelE) and of genes of the intracellular part of the pectin degradation
pathway (ogl, kduI, and kdgT), which are important for inducer formation and
transport, is dramatically reduced in induced conditions. In contrast,
expression of pelA, which encodes a pectate lyase important for E. chrysanthemi
pathogenicity, seems to be negatively regulated by CRP. The E. chrysanthemi crp
mutants have greatly decreased maceration capacity in potato tubers, chicory
leaves, and celery petioles as well as highly diminished virulence on
saintpaulia plants. These findings demonstrate that CRP plays a crucial role in
expression of the pectinolysis genes and in the pathogenicity of E.
chrysanthemi.

PMID: 9171393 [PubMed - indexed for MEDLINE]

181: J Bacteriol. 1997 Jun;179(11):3458-69. 

Maximization of transcription of the serC (pdxF)-aroA multifunctional operon by
antagonistic effects of the cyclic AMP (cAMP) receptor protein-cAMP complex and
Lrp global regulators of Escherichia coli K-12.

Man TK, Pease AJ, Winkler ME.

Department of Microbiology and Molecular Genetics, University of Texas Houston
Medical School, 77030-1501, USA.

The arrangement of the Escherichia coli serC (pdxF) and aroA genes into a
cotranscribed multifunctional operon allows coregulation of two enzymes required
for the biosynthesis of L-serine, pyridoxal 5'-phosphate, chorismate, and the
aromatic amino acids and vitamins. RNase T2 protection assays revealed two major
transcripts that were initiated from a promoter upstream from serC (pdxF).
Between 80 to 90% of serC (pdxF) transcripts were present in single-gene mRNA
molecules that likely arose by Rho-independent termination between serC (pdxF)
and aroA. serC (pdxF)-aroA cotranscripts terminated at another Rho-independent
terminator near the end of aroA. We studied operon regulation by determining
differential rates of beta-galactosidase synthesis in a merodiploid strain
carrying a single-copy lambda[phi(serC [pdxF]'-lacZYA)] operon fusion. serC
(pdxF) transcription was greatest in bacteria growing in minimal salts-glucose
medium (MMGlu) and was reduced in minimal salts-glycerol medium, enriched MMGlu,
and LB medium. serC (pdxF) transcription was increased in cya or crp mutants
compared to their cya+ crp+ parent in MMGlu or LB medium. In contrast, serC
(pdxF) transcription decreased in an lrp mutant compared to its lrp+ parent in
MMGlu. Conclusions obtained by using the operon fusion were corroborated by
quantitative Western immunoblotting of SerC (PdxF), which was present at around
1,800 dimers per cell in bacteria growing in MMGlu. RNase T2 protection assays
of serC (pdxF)-terminated and serC (pdxF)-aroA cotranscript amounts supported
the conclusion that the operon was regulated at the transcription level under
the conditions tested. Results with a series of deletions upstream of the P(serC
(pdxF)) promoter revealed that activation by Lrp was likely direct, whereas
repression by the cyclic AMP (cAMP) receptor protein-cAMP complex (CRP-cAMP) was
likely indirect, possibly via a repressor whose amount or activity was
stimulated by CRP-cAMP.

PMID: 9171388 [PubMed - indexed for MEDLINE]

182: Biochem Biophys Res Commun. 1997 May 29;234(3):564-7. 

Expression of the Escherichia coli thioredoxin gene is negatively regulated by
cyclic AMP.

Sa JH, Namgung MA, Lim CJ, Fuchs JA.

Department of Biochemistry, Kangwon National University, Chuncheon, South Korea.

Regulation of the Escherichia coli thioredoxin gene (trxA) was studied using
trxA-lac translational fusion constructed in the vector pMC1403. Synthesis of
beta-galactosidase from the trxA-lac fusion was found to be repressed in the
presence of lactose. A switch of carbon source from glucose to lactose and an
addition of cyclic AMP (cAMP) caused a decrease in beta-galactosidase synthesis
from the trxA-lac fusion. The repression effect of exogenous cAMP was not
observed in the crp mutant strain. The beta-galactosidase synthesis from the
trxA-lac fusion lacking a plausible cAMP-CRP binding site was not lowered in the
presence of lactose or in the addition of cAMP. Expression of the chromosomal
trxA gene was reduced by exogenous cAMP. These findings indicate that the
expression of the trxA gene is controlled by cAMP in a negative manner.

PMID: 9175752 [PubMed - indexed for MEDLINE]

183: Mol Microbiol. 1997 May;24(4):857-67. 

Catabolite repression by glucose 6-phosphate, gluconate and lactose in
Escherichia coli.

Hogema BM, Arents JC, Inada T, Aiba H, van Dam K, Postma PW.

E.C. Slater Institute, BioCentrum, University of Amsterdam, The Netherlands.

While catabolite repression by glucose has been studied extensively and is
understood in large detail in Enterobacteriaceae, catabolite repression by
carbohydrates that are not transported by the phosphotransferase system (PTS)
has always remained an enigma. Examples of non-PTS carbohydrates that cause
catabolite repression in Escherichia coli are gluconate, lactose and glucose
6-phosphate. In this article it is shown that enzyme IIA(Glc) of the PTS is not
involved in catabolite repression by these carbon sources. Carbon sources that
caused strong catabolite repression of beta-galactosidase lowered the
concentration of both cAMP and the cAMP receptor protein (CRP). A strong
correlation was found between the amounts of cAMP and CRP and the strength of
the repression. The levels of cAMP and CRP were modulated in various ways.
Neither overproduction of CRP nor an increased cAMP concentration could
completely relieve the repression by glucose 6-phosphate, lactose and gluconate.
Simultaneously increasing the cAMP and the CRP levels was lethal for the cells.
In a mutant expressing a constant amount of cAMP-independent CRP* protein,
catabolite repression was absent. The same was found in a mutant in which lac
transcription is independent of cAMP/CRP. These results, combined with the fact
that both the cAMP and the CRP levels are lowered by glucose 6-phosphate,
lactose and gluconate, lead to the conclusion that the decreased cAMP and CRP
levels are the cause of catabolite repression by these non-PTS carbon sources.

PMID: 9194712 [PubMed - indexed for MEDLINE]

184: Mol Microbiol. 1997 May;24(3):617-27. 

Characterization of the negative elements involved in silencing the bgl operon
of Escherichia coli: possible roles for DNA gyrase, H-NS, and CRP-cAMP in
regulation.

Mukerji M, Mahadevan S.

Developmental Biology and Genetics Laboratory, Indian Institute of Science,
Bangalore, India.

The bgl operon of Escherichia coli is rendered cryptic and uninducible in
wild-type cells by the presence of DNA structural elements that negatively
regulate transcription. We have carried out a detailed analysis of the sequences
implicated in negative regulation. Fine-structure deletion analysis of the
upstream sequences showed the presence of at least two elements involved in
silencing the promoter. Chemical probing of genomic DNA in vivo showed that a
region of dyad symmetry, present upstream of the promoter, is hypersensitive to
KMnO4. The hypersensitive region detected corresponds to the potential cruciform
structure implicated earlier in negative regulation. Enhancement of
transcription from the wild-type promoter, observed in the presence of the
gyrase inhibitor novobiocin, was absent in a mutant that carried point mutations
in the inverted repeat. This observation suggests that the activation seen in a
gyrase mutant is mediated by destabilization of the cruciform because of reduced
supercoiling. Deletion of sequences downstream of the potential cruciform also
resulted in an increase in transcription, indicating the presence of a second
regulatory element. Measurement of transcription from the bgl promoter carrying
the deletion, in a strain that has a mutation in the hns gene, indicated that
this region is likely to be involved in binding to H-NS or a protein regulated
by H-NS, which acts as a non-specific repressor. We also provide evidence which
suggests that transcriptional activation by mutations at the cAMP receptor
protein (CRP)-binding site is mediated partly by antagonization of the negative
effect of H-NS by CRP-cAMP as a result of its increased affinity for the mutant
site.

PMID: 9179854 [PubMed - indexed for MEDLINE]

185: Mol Gen Genet. 1997 Apr 28;254(4):440-8. 

Autogenous and global control of the flagellar master operon, flhD, in
Salmonella typhimurium.

Kutsukake K.

Department of Applied Biochemistry, Faculty of Applied Biological Science,
Hiroshima University, Japan.

Expression of the flagellar master operon, flhD, is known to be affected by
growth conditions and by mutations in a variety of genes. In the present work,
the transcriptional control of the Salmonella typhimurium flhD operon was
investigated in various genetic backgrounds. First, we examined the effect of
mutations in the global regulators cAMP-CRP, H-NS, OmpR and RpoS. Mutations in
the cya, crp or hns gene reduced but did not eliminate flhD expression. However,
expression was completely inhibited in the cya hns and crp hns double mutants.
These results indicate that cAMP-CRP and H-NS independently activate the flhD
operon and that maximal expression is attained in the presence of both
regulators. On the other hand, the ompR and rpoS mutations did not affect either
the motility phenotype or flhD expression. We next examined the expression of a
chromosomal flhD-lac fusion gene in the presence of a plasmid carrying the
wild-type flhD operon. It was found that under this condition the chromosomal
flhD operon was repressed or activated, depending on the intracellular activity
of FliA, an alternative sigma factor specific for late flagellar operons. In the
absence of FliA or in the presence of both FliA and its cognate anti-sigma
factor FlgM, the flhD operon was autogenously repressed, whereas in the flgM
mutant background it was autogenously activated in the presence of FliA. This
autoregulation was still observed in the crp or hns mutant background,
indicating that the autogenous control is achieved by a mechanism that is
independent of the cAMP-CRP and H-NS regulatory pathways.

PMID: 9180698 [PubMed - indexed for MEDLINE]

186: J Mol Biol. 1997 Apr 11;267(4):778-93. 

Gene organization and transcriptional regulation of the gntRKU operon involved
in gluconate uptake and catabolism of Escherichia coli.

Izu H, Adachi O, Yamada M.

Department of Biological Chemistry, Faculty of Agriculture, Yamaguchi
University, Japan.

We cloned and characterized the gntRKU operon encoding part of the GntI system
involved in gluconate uptake and catabolism by Escherichia coli. The operon was
shown to encode its repressor, a thermoresistant gluconate kinase, and a low
affinity gluconate permease. CAT fusion analysis revealed that the operon has a
promoter for gntR and another for gntKU, and that the gntR gene is
constitutively expressed, while that of gntKU is regulated positively by the
cAMP-CRP complex and negatively by GntR. Read-through transcription from the
gntR promoter into gntK was decreased in the presence of GntR, although GntR did
not repress its own promoter. In addition, transcriptional attenuation was
observed after the gntK gene, so gntU expression is reduced presumably to
modulate the production of the low affinity gluconate permease according to the
available concentration of gluconate.

PMID: 9135111 [PubMed - indexed for MEDLINE]

187: J Bacteriol. 1997 Apr;179(7):2410-7. 

Cyclic AMP receptor protein functions as a repressor of the osmotically
inducible promoter proP P1 in Escherichia coli.

Xu J, Johnson RC.

Department of Biological Chemistry, UCLA School of Medicine, Los Angeles,
California 90095-1737, USA.

Transcription of the proP gene, encoding a transporter of the osmoprotectants
proline and glycine betaine, is controlled from two promoters, P1 and P2, that
respond primarily to osmotic and stationary-phase signals, respectively. The P1
promoter is normally expressed at a very low level under low or normal medium
osmolarity. We demonstrate that the binding of the cyclic AMP (cAMP) receptor
protein (CRP) to a site centered at -34.5 within the promoter is responsible for
the low promoter activity under these conditions. A brief period of reduced CRP
binding in early log phase corresponds to a transient burst of P1 transcription
upon resumption of growth in Luria-Bertani broth. A CRP binding-site mutation or
the absence of a functional crp gene leads to high constitutive expression of
P1. We show that the binding of CRP-cAMP inhibits transcription by purified RNA
polymerase in vitro at P1, but this repression is relieved at moderately high
potassium glutamate concentrations. Likewise, open-complex formation at P1 in
vivo is inhibited by the presence of CRP under low-osmolarity conditions.
Because P1 expression can be further induced by osmotic upshifts in a delta crp
strain or in the presence of the CRP binding-site mutation, additional controls
exist to osmotically regulate P1 expression.

PMID: 9079929 [PubMed - indexed for MEDLINE]

188: J Mol Biol. 1997 Mar 14;266(5):866-76. 

Design of CytR regulated, cAMP-CRP dependent class II promoters in Escherichia
coli: RNA polymerase-promoter interactions modulate the efficiency of CytR
repression.

Kristensen HH, Valentin-Hansen P, Sogaard-Andersen L.

Department of Molecular Biology, Odense University, Denmark.

In CytR regulated promoters in Escherichia coli, the cAMP-CRP complex acts as a
transcriptional activator as well as a co-repressor for the CytR protein.
Repression by CytR depends on the formation of nucleoprotein complexes in which
CytR binds cooperatively to the DNA with one or two cAMP-CRP complexes. Here, we
demonstrate that in order to establish CytR regulation in a cAMP-CRP dependent
class II promoter with a single CRP site (CRP site centred around position
-40.5) in which the CytR operator is located upstream of the CRP site, high
affinity binding sites for both regulators are required. The efficiency of CytR
regulation was observed to be modulated by RNA polymerase (RNAP)-promoter
interactions. Specifically, in class II promoters with a single CRP site, the
efficiency of CytR regulation was found to correlate inversely with cAMP-CRP
independent promoter activity. These observations can be reconciled in a
competition model for CytR regulation in which CytR and RNAP compete for
cooperative binding with cAMP-CRP to the promoters in vivo. In this model, two
mutually exclusive ternary complexes can be formed: a CytR/cAMP-CRP/promoter
repression complex and an RNAP/cAMP-CRP/promoter activation complex. Thus, CytR
regulation critically depends on formation of a repression complex that binds
the promoter with sufficiently high affinity to exclude formation of the
competing activation complex. We suggest that the transition from repression to
activation involves a switch in the protein-protein interactions made by
cAMP-CRP from CytR to RNAP. On the basis of the regulatory features of the
promoters analysed here, we speculate about the advantages offered by the
structural complexity of natural CytR/cAMP-CRP regulated promoters.

PMID: 9086266 [PubMed - indexed for MEDLINE]

189: Arch Microbiol. 1997 Mar 7;167(2/3):78-88. 

Anaerobic citrate metabolism and its regulation in enterobacteria

Bott M.

Mikrobiologisches Institut, Eidgenossische Technische Hochschule, ETH-Zentrum,
Schmelzbergstrasse 7, CH-8092 Zurich, Switzerland

Several species of enterobacteria are able to utilize citrate as carbon and
energy source. Under oxic conditions in the presence of a functional
tricarboxylic acid cycle, growth on this compound solely depends on an
appropriate transport system. During anaerobiosis, when 2-oxoglutarate
dehydrogenase is repressed, some species such as Klebsiella pneumoniae and
Salmonella typhimurium, but not Escherichia coli, are capable of growth on
citrate by a Na+-dependent pathway forming acetate, formate, and CO2 as
products. During the last decade, several novel features associated with this
type of fermentation have been discovered in K. pneumoniae. The biotin protein
oxaloacetate decarboxylase, one of the key enzymes of the pathway besides
citrate lyase, is a Na+ pump. Recently it has been shown that the proton
required for the decarboxylation of carboxybiotin is taken up from the side to
which Na+ ions are pumped, and a membrane-embedded aspartate residue that is
probably involved both in Na+ and in H+ transport was identified. The Na+
gradient established by oxaloacetate decarboxylase drives citrate uptake via
CitS, a homodimeric carrier protein with a simultaneous-type reaction mechanism,
and NADH formation by reversed electron transfer involving formate
dehydrogenase, quinone, and a Na+-dependent NADH:quinone oxidoreductase. All
enzymes specifically required for citrate fermentation are induced under anoxic
conditions in the presence of citrate and Na+ ions. The corresponding genes form
a cluster on the chromosome and are organized as two divergently transcribed
operons. Their co-ordinate expression is dependent on a two-component system
consisting of the sensor kinase CitA and the response regulator CitB. The citAB
genes are part of the cluster and are positively autoregulated. In addition to
CitA/CitB, the cAMP receptor protein (Crp) is involved in the regulation of the
citrate fermentation enzymes, subjecting them to catabolite repression.

PMID: 9042746 [PubMed - as supplied by publisher]

190: J Bacteriol. 1997 Mar;179(6):1909-17. 

Regulation of the Salmonella typhimurium pepT gene by cyclic AMP receptor
protein (CRP) and FNR acting at a hybrid CRP-FNR site.

Lombardo MJ, Lee AA, Knox TM, Miller CG.

Department of Microbiology, University of Illinois at Urbana-Champaign, Urbana
61801, USA.

The Salmonella typhimurium pepT gene is induced nearly 30-fold in response to
anaerobiosis. Anaerobic expression is dependent on the transcriptional regulator
encoded by fnr (previously oxrA). Primer extension analysis and site-directed
mutagenesis experiments show that pepT is transcribed from two sigma 70
promoters. One promoter (P1) is FNR dependent and anaerobically induced, while
the other (P2) appears to be constitutive. The potABCD operon is divergently
transcribed from a promoter near pepT P2. Sequence analysis of pepT promoter
mutations which either elevate anaerobic expression or confer constitutive
expression revealed that these mutations affect the -10 region of the P1 or P2
promoter, respectively. The pepT200 mutation, which changes the -10 region of
the FNR-dependent P1 promoter to the consensus, has the surprising effect of
allowing five- to sevenfold anaerobic induction in the absence of FNR. We have
shown that the anaerobic induction of pepT-lacZ in a pepT200 fnr strain is
dependent on wild-type alleles of both crp and cya. In a pepT200 pepT-lacZ
strain, beta-galactosidase activity was elevated aerobically in the presence of
exogenous cyclic AMP (cAMP) and was elevated also in succinate minimal medium
relative to its level in glucose minimal medium. Primer extension analysis
confirmed that P1 is the cAMP receptor protein (CRP)-dependent promoter.
Site-directed mutagenesis experiments indicated that a hybrid CRP-FNR binding
site positioned at -41 of the P1 promoter is utilized by both FNR and CRP.
CRP-cAMP also appeared to repress FNR-dependent transcription of pepT under
anaerobic conditions in both the pepT+ and pepT200 backgrounds. Although both
CRP and FNR are capable of binding the hybrid site and activating transcription
of pepT, CRP requires the consensus -10 sequence for efficient activation.

PMID: 9068635 [PubMed - indexed for MEDLINE]

191: Biochem Biophys Res Commun. 1997 Feb 24;231(3):692-5. 

Effect of glucose concentration on swimming motility in enterobacteria.

Lai HC, Shu JC, Ang S, Lai MJ, Fruta B, Lin S, Lu KT, Ho SW.

School and Graduate Institute of Medical Technology, College of Medicine,
National Taiwan University, Taipei, Taiwan, Republic of China.

Since the observation that glucose prevents the synthesis of flagella in
Escherichia coli was first reported in 1967, many studies have addressed the
underlying mechanism. Currently, it is thought that an increase in glucose
concentration decreases the intracellular CRP/cAMP concentration. This leads to
an inhibitory effect on the expression of the flhD operon, the master operon for
flagella synthesis. In our study on defining factors influencing the cell
differentiation of Serratia marcescens, glucose catabolite repression of hag
expression and swimming/swarming motility was not observed. Further experiments
using a simple swimming motility assay extended this observation to other
members of Enterobacteriaceae. Although the underlying mechanism is still
uncharacterised, our results suggest that glucose catabolite repression of
swimming motility may not be a common phenomenon in Enterobacteriaceae.

PMID: 9070873 [PubMed - indexed for MEDLINE]

192: Mol Microbiol. 1997 Feb;23(4):835-45. 

Transcriptional activation by FNR and CRP: reciprocity of binding-site
recognition.

Sawers G, Kaiser M, Sirko A, Freundlich M.

Nitrogen Fixation Laboratory, John Innes Centre, Norwich, UK. gary.sawers@bbsrc

Anaerobic expression of the focA pfl operon is dependent on the transcription
factors ArcA and FNR and transcription is directed by multiple, anaerobically
regulated promoters. A FNR-binding site is centred at -41.5 bp relative to the
P6 promoter, inactivation of which severely impairs anaerobic expression of the
complete operon. Mutations were introduced into this binding site to create a
consensus recognition site for the cAMP-receptor protein, CRP (CC-site), and one
that was recognised by both CRP and FNR (CF-site). Transcription directed by
these mutant binding sites in vivo in different promoter constructs was analysed
by primer extension and by constructing lacZ operon fusions. With a derivative
including only the P6 promoter and the CF-binding site, transcription was shown
to be independent of oxygen and was activated by CRP or FNR. In agreement with
previous findings, FNR only activated transcription anaerobically. In a
construct including the CC-binding site transcription was strong. CRP dependent
and initiated at the identical site to the wild-type promoter. Transcription
activation from the CC-site was exquisitely sensitive to low cAMP concentration.
Surprisingly, in a crp mutant, anaerobically inducible, FNR-dependent
transcription directed by the CC-site was detected, indicating that FNR can
recognise a consensus CRP-binding site in vivo. A strain unable to synthesise
CRP or FNR exhibited no transcription from the P6 promoter. Essentially the same
results were observed in a series of constructs that also included the promoter
P7 and its regulatory sequences. Evidence is also presented which demonstrates
that CRP activates transcription from the natural FNR-binding site of the P6
promoter. In vitro DNA-binding studies showed that CRP specifically interacted
with the FNR-binding site, protecting exactly the same sequence as that
protected by the FNR protein. Interaction of CRP with the natural FNR-binding
site was reduced greater than 50-fold compared to its interaction with the
mutant CC-binding site. Although we could not demonstrate that FNR interacted
with the CC-binding site in vitro, it did bind to the CF-site giving the same
protection as observed with the wild-type FNR-binding site. FNR also activated
transcription from the CF-site in vitro, giving further support to the idea that
a single functional DNA half-site is sufficient to direct binding and
transcription activation by a dimeric transcription factor.

PMID: 9157253 [PubMed - indexed for MEDLINE]

193: Arch Microbiol. 1997 Feb-Mar;167(2-3):78-88. 

Anaerobic citrate metabolism and its regulation in enterobacteria.

Bott M.

Mikrobiologisches Institut, Eidgenossische Technische Hochschule, ETH-Zentrum,
Schmelzbergstrasse 7, CH-8092 Zurich, Switzerland. bott@micro.biol.ethz.ch

Several species of enterobacteria are able to utilize citrate as carbon and
energy source. Under oxic conditions in the presence of a functional
tricarboxylic acid cycle, growth on this compound solely depends on an
appropriate transport system. During anaerobiosis, when 2-oxoglutarate
dehydrogenase is repressed, some species such as Klebsiella pneumoniae and
Salmonella typhimurium, but not Escherichia coli, are capable of growth on
citrate by a Na+-dependent pathway forming acetate, formate, and CO2 as
products. During the last decade, several novel features associated with this
type of fermentation have been discovered in K. pneumoniae. The biotin protein
oxaloacetate decarboxylase, one of the key enzymes of the pathway besides
citrate lyase, is a Na+ pump. Recently it has been shown that the proton
required for the decarboxylation of carboxybiotin is taken up from the side to
which Na+ ions are pumped, and a membrane-embedded aspartate residue that is
probably involved both in Na+ and in H+ transport was identified. The Na+
gradient established by oxaloacetate decarboxylase drives citrate uptake via
CitS, a homodimeric carrier protein with a simultaneous-type reaction mechanism,
and NADH formation by reversed electron transfer involving formate
dehydrogenase, quinone, and a Na+-dependent NADH:quinone oxidoreductase. All
enzymes specifically required for citrate fermentation are induced under anoxic
conditions in the presence of citrate and Na+ ions. The corresponding genes form
a cluster on the chromosome and are organized as two divergently transcribed
operons. Their co-ordinate expression is dependent on a two-component system
consisting of the sensor kinase CitA and the response regulator CitB. The citAB
genes are part of the cluster and are positively autoregulated. In addition to
CitA/CitB, the cAMP receptor protein (Crp) is involved in the regulation of the
citrate fermentation enzymes, subjecting them to catabolite repression.

Publication Types:
    Review

PMID: 9133329 [PubMed - indexed for MEDLINE]

194: Eur J Biochem. 1997 Feb 1;243(3):660-9. 

Stability and kinetics of unfolding and refolding of cAMP receptor protein from
Escherichia coli.

Malecki J, Wasylewski Z.

Department of Physical Biochemistry, Jagiellonian University, Krakow, Poland.

cAMP receptor protein (CRP) is involved in regulation of expression of several
genes in Escherichia coli. The protein is a homodimer and each monomer is folded
into two distinct structural domains. The mechanism of the biological activity
of the protein may involve the interaction between the subunits and domains. In
order to determine the interaction between the subunits or domains of CRP, we
have studied the reversible denaturation of the protein by guanidine
hydrochloride. The unfolding and refolding kinetics of CRP was monitored using
stopped-flow fluorescence spectroscopy at 20 degrees C and pH 7.9. The results
of CRP denaturation indicate that the transition can be described by a
three-state model: (CRP native)2<=> 2 (CRP native)<=>2 (CRP denatured). The
faster process, characterized by the relaxation time tau 2 = 80 +/- 3 ms,
corresponds to the dissociation of CRP dimer into monomers. The slower process
has the relaxation time tau t = 1.9 +/- 0.1 s and corresponds to the cooperative
unfolding of CRP monomer. The free energy change in the absence of denaturant
upon CRP dissociation is delta G dis degrees = 46.9 +/- 2.5 kJ/mol and for
monomer unfolding delta G unf degrees = 30.9 +/- 1.3 kJ/mol. The thermal
unfolding of CRP was studied by circular dichroism and fluorescence spectroscopy
at various guanidine hydrochloride concentrations. It has been found that the
native protein is maximally stable at about 21 +/- 0.3 degrees C and is
denatured upon heating and cooling from this temperature. The apparent free
energy change for CRP unfolding at 21 degrees C is equal to 30.5 +/- 0.4 kJ/mol
and the apparent specific heat change is equal to delta Cp, app = 10.7 +/- 0.7
kJ mol-1 K-1. The predicted values of cold denaturation midpoint is equal to tau
G = -18.8 +/- 1.5 degrees C and for high-temperature transition tau G = 63.1 +/-
1.5 degrees C. The predicted midpoint of high-temperature unfolding transition
is about the same as determined experimentally.

PMID: 9057829 [PubMed - indexed for MEDLINE]

195: Acta Biochim Pol. 1997;44(1):153-7. 

Characterization of the Escherichia coli gene encoding a new member of the
short-chain dehydrogenase/reductase (SDR) family.

Sirko A, Weglenska A, Hryniewicz M, Hulanicka DM.

Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw,
Poland. asirko@ibbrain.ibb.waw.pl

The nucleotide sequence of a chromosomal DNA fragment located upstream from the
cysPTWAM operon of Escherichia coli was established. Sequence analysis indicates
the presence of an open reading frame which has been designated ucpA (upstream
cys P). The potential protein products exhibits strong sequence homology to the
members of a large protein family, short-chain dehydrogenases/reductases.
Involvement of Crp, FruR and IHF in the regulation of ucpA transcription in vivo
was demonstrated.

PMID: 9241368 [PubMed - indexed for MEDLINE]

196: Adv Exp Med Biol. 1997;412:303-10. 

Regulators of Escherichia coli K99 region 1 genes.

Lo-Tseng T, Lee J, Isaacson RE.

University of Illinois, Department of Veterinary Pathobiology, Urbana 61801,
USA.

Expression of K99 is highly regulated being dependent on 8 K99-specific genes
and several host-specific genes including cyclic AMP receptor protein (Crp) and
leucine responsive protein (Lrp). The 8 K99-specific genes are organized into 3
separately regulated clusters (regions I-III) with region I and II genes being
dependent on Crp. Using TnphoA tagged K99 genes, Lrp was shown to be required
for expression of region I genes. Differential methylation of GATC boxes is a
common method by which Lrp functions as a regulator. Two GATC boxes are present
adjacent to the 5' end of fanA, the first gene. Using the restriction enzymes
Dpn I and Mbo I which recognize methylated and non-methylated GATC boxes,
respectively, it was shown that differential methylation was not a mechanism
regulating K99 expression. Using a gel mobility shift assay and protein extracts
from various strains, it was shown that a 625 bp DNA fragment adjacent to the 5'
end of fanA bound protein prepared from Lrp+ strains but not from Lrp- strains.
While region I genes also require CRP for expression, the same degree of gel
shift was observed when the extract was prepared from a Crp- strain. The
products of fanA and fanB are believed to be positive regulators. However,
protein extracts from strains with or without fanA and fanB caused the same
degree of gel shift. Thus, while there are a variety of regulators necessary for
region I gene expression, only Lrp or Lrp regulated proteins bind to the
promoter region 5' to fanA.

PMID: 9192034 [PubMed - indexed for MEDLINE]

197: J Biol Chem. 1996 Dec 27;271(52):33242-55. 

Multiple specific CytR binding sites at the Escherichia coli deoP2 promoter
mediate both cooperative and competitive interactions between CytR and cAMP
receptor protein.

Perini LT, Doherty EA, Werner E, Senear DF.

Department of Molecular Biology and Biochemistry, University of California,
Irvine, California 92697, USA. dfsenear@uci.edu

Binding of cAMP receptor protein (CRP) and CytR mediates both positive and
negative control of transcription from Escherichia coli deoP2. Transcription is
activated by CRP and repressed by a multi-protein CRP.CytR.CRP complex. The
latter is stabilized by cooperative interactions between CRP and CytR. Similar
interactions at the other transcriptional units of the CytR regulon coordinate
expression of the transport proteins and enzymes required for nucleoside
catabolism. A fundamental question in both prokaryotic and eukaryotic gene
regulation is how combinatorial mechanisms of this sort regulate differential
expression. To understand the combinatorial control mechanism at deoP2, we have
used quantitative footprint and gel shift analysis of CRP and CytR binding to
evaluate the distribution of ligation states. By comparison to distributions for
other CytR-regulated promoters, we hope to understand the roles of individual
states in differential gene expression. The results indicate that CytR binds
specifically to multiple sites at deoP2, including both the well recognized CytR
site flanked by CRP1 and CRP2 and also sites coincident with CRP1 and CRP2.
Binding to these multiple sites yields both cooperative and competitive
interactions between CytR and CRP. Based on these findings we propose that CytR
functions as a differential modulator of CRP1 versus CRP2-mediated activation.
Additional high affinity specific sites are located at deoP1 and near the middle
of the 600-base pair sequence separating P1 and P2. Evaluation of the DNA
sequence requirement for specific CytR binding suggests that a limited array of
contiguous and overlapping CytR sites exists at deoP2. Similar extended arrays,
but with different arrangements of overlapping CytR and CRP sites, are found at
the other CytR-regulated promoters. We propose that competition and
cooperativity in CytR and CRP binding are important to differential regulation
of these promoters.

PMID: 8969182 [PubMed - indexed for MEDLINE]

198: J Bacteriol. 1996 Dec;178(23):6930-6. 

Effects of nutrition and growth rate on Lrp levels in Escherichia coli.

Landgraf JR, Wu J, Calvo JM.

Section of Biochemistry, Molecular and Cell Biology, Cornell University, Ithaca,
New York 14853, USA.

Lrp (leucine-responsive regulatory protein) activates some Escherichia coli
operons that function in anabolism and represses others involved in catabolism
(for a review, see J. M. Calvo and R. G. Matthews, Microbiol. Rev. 58:466-490,
1994). This overall pattern suggests that Lrp may help cells adapt to changes in
the nutritional environment. Here, we tested the idea that the nutritional
richness of the medium determines the amount of Lrp in cells. Lrp was measured
directly by Western blotting (immunoblotting) in cells grown in a chemically
defined rich medium or in a minimal medium. In addition, transcription from the
lrp promoter was assessed with a lacZ reporter gene. The results with these two
different measurements were nearly the same, indicating that under the
conditions employed, beta-galactosidase measurements can accurately reflect Lrp
levels. For cells in a minimal medium, Lrp levels were consistently lowest
during the logarithmic phase of growth, but overall, there was not much
variation in levels as a function of growth phase (1.3-fold difference between
highest and lowest values). However, for cells in a rich medium, Lrp levels
dropped 3- to 4-fold during the lag phase, remained constant during the log
phase, and then rose to starting levels upon entry into the stationary phase.
When cells in the log phase were compared, Lrp levels were 3- to 4-fold higher
in cells growing in a minimal medium than those in a rich medium. The levels of
lrp expression were the same or slightly higher in strains containing mutations
in rpoS, cya, or crp compared with wild-type strains, suggesting that neither
RpoS nor the cyclic AMP (cAMP) receptor protein-cAMP complex is required for
expression. On the other hand, lrp expression was severely restricted in cells
that could not make ppGpp because of mutations in relA and spoT. The reduced
expression of lrp during logarithmic growth in a rich medium may be due to low
ppGpp levels under these conditions. The repressive effects of rich medium and
the stimulatory effects of ppGpp were also observed with a construct having only
a minimal lrp promoter (-57 to +21). The results of other experiments suggest
that Lrp levels vary inversely with the growth rate of cells instead of being
determined by some component of the medium.

PMID: 8955316 [PubMed - indexed for MEDLINE]

199: Mol Gen Genet. 1996 Nov 27;253(1-2):198-204. 

Down regulation of cAMP production by cAMP receptor protein in Escherichia coli:
an assessment of the contributions of transcriptional and posttranscriptional
control of adenylate cyclase.

Inada T, Takahashi H, Mizuno T, Aiba H.

Department of Molecular Biology, School of Science, Nagoya University, Japan.

Escherichia coli cells that are deficient in the cAMP receptor protein (CRP)
overproduce cAMP. We and others have previously found that transcription of the
adenylate cyclase gene (cya) is negatively regulated by the CRP-cAMP complex.
Here, we have investigated the contribution of this transcriptional regulation
to the control of cAMP levels. Several variants of the cya gene have been
constructed and characterized with respect to their expression and their ability
to produce cAMP. Overproduction of cAMP in a crp- background was reduced from
200-fold to 50-fold when transcriptional regulation by CRP-cAMP was eliminated
by replacing the cya promoter with the constitutive bla promoter. When the
C-terminal 48 amino acids of adenylate cyclase were deleted without changing the
promoter, the degree of overproduction of cAMP was reduced to 4-fold. Finally,
the increase in cAMP level observed in crp- cells was almost completely
abolished when the truncated cyclase was expressed from the bla promoter. We
conclude that transcriptional regulation of cya does indeed play a role in the
down-regulation of cAMP production by CRP, although the major regulation is
exerted at the posttranscriptional level. The C-terminal region comprising the
last 48 amino acids of cyclase is responsible for the posttranscriptional
regulation. A simple new method for the determination of cAMP is also described.

PMID: 9003304 [PubMed - indexed for MEDLINE]

200: J Mol Biol. 1996 Oct 25;263(2):126-39. 

Regulation of HU alpha and HU beta by CRP and FIS in Escherichia coli.

Claret L, Rouviere-Yaniv J.

Institute de Biologie Physico-Chimique, Laboratoire de Physiologie Bacterienne,
Paris, France.

The dimeric histone-like protein HU, one of the most abundant DNA binding
proteins of Escherichia coli, is encoded by two closely related but unlinked
genes, hupA and hupB. Overproduction of one or the other of the subunits has
been shown to induce the SOS response and mucoidy. To understand how the
synthesis of this protein is coordinated, we studied the transcription control
of the two hup genes. We show here that CRP stimulated the transcription of both
genes. In contrast, the FIS protein, one of the major positive regulators of the
stable RNA operons, stimulated the transcription of the hupA gene, whereas it
repressed that of the hupB gene. Moreover, stringent control, which like FIS
also regulates the transcription of the stable RNA operons, affected the hupB
transcription while it had no effect on hupA. This opposite regulation of the
transcription of the two HU genes is reflected at the protein level signifying
that changes in the composition of HU occur upon changes in the environment. It
is rather unexpected that such divergent transcriptional regulation controls the
two genes encoding a dimeric protein.

PMID: 8913296 [PubMed - indexed for MEDLINE]

201: Mol Microbiol. 1996 Oct;22(1):21-9. 

FIS is a regulator of metabolism in Escherichia coli.

Gonzalez-Gil G, Bringmann P, Kahmann R.

Institut fur Genbiologische Forschung Berlin GmbH, Berlin, Germany.
Gardenia.Gonzalezgil@Schering.DE

The Escherichia coli DNA-binding protein FIS (factor for inversion stimulation)
stimulates site-specific recombination reactions catalysed by DNA invertases and
is an activator of stable RNA synthesis. To address the question of whether FIS
is involved in other cellular processes we have identified and sequenced
proteins whose expression pattern is affected by FIS. This has led to the
identification of several E. coli genes whose expression in vivo is either
enhanced or repressed by FIS. All of these genes encode enzymes or transport
proteins involved in the catabolism of sugars or nucleic acids, and their
expression is also dependent on the cAMP-CRP complex. In most cases studied the
regulation by FIS is indirect and occurs through effects on the synthesis of the
respective repressor proteins. We conclude that FIS is a transcriptional
modulator involved in the regulation of metabolism in E. coli.

PMID: 8899705 [PubMed - indexed for MEDLINE]

202: Proc Natl Acad Sci U S A. 1996 Sep 17;93(19):10151-5. 

Dual-function regulators: the cAMP receptor protein and the CytR regulator can
act either to repress or to activate transcription depending on the context.

Rasmussen PB, Holst B, Valentin-Hansen P.

Department of Molecular Biology, Odense University, Denmark.

Studies of gene regulation have revealed that several transcriptional regulators
can switch between activator and repressor depending upon both the promoter and
the cellular context. A relatively simple prokaryotic example is illustrated by
the Escherichia coli CytR regulon. In this system, the cAMP receptor protein
(CRP) assists the binding of RNA polymerase as well as a specific negative
regulator, CytR. Thus, CRP functions either as an activator or as a corepressor.
Here we show that, depending on promoter architecture, the CRP/CytR
nucleoprotein complex has opposite effects on transcription. When acting from a
site close to the DNA target for RNA polymerase, CytR interacts with CRP to
repress transcription, whereas an interaction with CRP from appropriately
positioned upstream binding sites can result in formation of a huge
preinitiation complex and transcriptional activation. Based on recent results
about CRP-mediated regulation of transcription initiation and the finding that
CRP possesses discrete surface-exposed patches for protein-protein interaction
with RNA polymerase and CytR, a molecular model for this dual regulation is
discussed.

PMID: 8816767 [PubMed - indexed for MEDLINE]

203: Microbiology. 1996 Sep;142 ( Pt 9):2429-37. 

Stringent and growth-rate-dependent control of the gua operon of Escherichia
coli K-12.

Davies IJ, Drabble WT.

Department of Biochemistry, University of Southampton, UK.

The promoter of the gua operon has been located by transcript mapping using
primer extension with reverse transcriptase. The surrounding nucleotide sequence
has features characteristic of promoters under stringent and
growth-rate-dependent regulation, namely a GC-rich discriminator next to the -10
hexamer, an upstream AT-rich sequence (the UP element) and potential FIS-binding
sites. Transcriptional activity of the gua promoter was examined using
transcriptional fusions to lacZ placed at a single chromosomal location.
Expression from gua was reduced under stringent conditions in vivo, and varied
with growth rate. Growth-rate control was independent of guanine-mediated
repression. A fusion in which the GC-rich discriminator was mutated by insertion
of an AT-rich oligonucleotide was used to demonstrate the importance of this
region in control. Both stringent and growth-rate-dependent controls were
abolished by the mutation. Other potential regulatory signals in the vicinity of
the gua promoter are a pur operator (binding site for the PurR repressor), a gua
operator, a DnaA-binding site and a CRP/FNR-binding sequence. The gua promoter
lies back-to-back with the promoter for xseA (exonuclease VII), the two
promoters being separated by only 20 bp.

PMID: 8828209 [PubMed - indexed for MEDLINE]

204: EMBO J. 1996 Aug 15;15(16):4358-67. 

Transcription factor recognition surface on the RNA polymerase alpha subunit is
involved in contact with the DNA enhancer element.

Murakami K, Fujita N, Ishihama A.

Department of Molecular Genetics, National Institute of Genetics, Mishima,
Shizuoka, Japan.

The carboxy-terminal one-third of Escherichia coli RNA polymerase alpha subunit
plays a key role in transcription regulation by a group of protein transcription
factors and DNA enhancer (UP) elements. The roles of individual amino acid
residues within this regulatory domain of the alpha subunit were examined after
systematic mutagenesis of the putative contact regions (residues 258-275 and
297-298) for the cAMP receptor protein (CRP). The reconstituted RNA polymerases
containing the mutant alpha subunits were examined for their response to
transcription activation by cAMP-CRP and the rrnBP1 UP element. Mutations
affecting CRP responsiveness were located on the surface of the putative CRP
contact helix and most of these mutations also influenced the response to the
rrnB UP element. These observations raise the possibility that the CRP contact
surface is also involved in contact with the DNA UP element, although some amino
acid residues within this region play different roles in molecular communication
with CRP and the UP element. Among the amino acid residues constituting the
contact surface, Arg265 was found to play a major role in response to both CRP
and the DNA UP element. Judged by DNase I footprinting analysis, alpha mutants
defective in transcription from the CRP-dependent lacP1 promoter showed
decreased activity in the cooperative binding of CRP. Likewise, mutants
defective in rrnBP1 transcription showed decreased binding to the UP element.
The amino acid residues important for contact with both CRP and DNA are
conserved in the alpha subunits of not only bacterial, but also chloroplast RNA
polymerases.

PMID: 8861963 [PubMed - indexed for MEDLINE]

205: Microbiol Res. 1996 Aug;151(3):273-80. 

Expression of heat shock protein D 48.5 of Escherichia coli is subject to
modulation by catabolite repression.

Peruski LF Jr.

Enteric Microbiology Branch, U.S. Naval Medical Research Unit No.3, Cairo,
Egypt.

The Escherichia coli heat shock regulon consists of approximately twenty
polypeptides that are coordinately and transiently induced upon a temperature
upshift under the control of an alternative sigma factor, designated sigma-32 or
HtpR. Preliminary observations on one of the proteins of the heat shock
response, protein D 48.5, suggested that its induction by sigma-32 during heat
shock may be modulated by catabolite repression. In this study, a disk diffusion
assay was used to screen the effect of several compounds on the expression of a
lacZ fusion in the gene encoding protein D 48.5. This assay indicated that the
expression of this protein was controlled, at least in part, by the catabolite
repression response. A more indepth analysis of the expression of protein D 48.5
under both steady-state and heat shock conditions was conducted in both a wild
type and cya crp background. This analysis revealed that in the cya crp
background, the steady-state level of protein D 48.5 was elevated relative to
the wildtype, but that the heat shock induction of the protein was reduced in
magnitude relative to the wild type strain, suggesting a direct link between
these two global responses. The lacZ fusion in the structural gene for protein D
48.5 should prove useful as a reporter mechanism to probe the physiology and
regulation of the heat shock response.

PMID: 8817918 [PubMed - indexed for MEDLINE]

206: J Bacteriol. 1996 Jun;178(11):3331-4. 

Cyclic AMP receptor protein positively controls gyrA transcription and alters
DNA topology after nutritional upshift in Escherichia coli.

Gomez-Gomez JM, Baquero F, Blazquez J.

Servico de Microbiologia, Hospital Ramon y Cajal, Madrid, Spain.

The expression of a transcriptional gyrA-lacZ gene fusion throughout the
Escherichia coli growth cycle and the effect that mutation delta crp39 had on
this expression were studied. The data obtained indicate that the expression of
gyrA is growth phase dependent and under the positive control of the cyclic AMP
receptor protein (CRP). Complementation analysis of gyrA-lacZ expression with
wild-type CRP or variant CRP pc (with a T-to-A mutation at position 158) in a
CRP-deficient background suggests that this CRP action is mediated by a class I
or class II CRP-dependent promoter(s). Our results also indicate that CRP may be
involved in the modulation of DNA topology in the transition from the lag period
to the exponential phase of growth.

PMID: 8655515 [PubMed - indexed for MEDLINE]

207: Mol Microbiol. 1996 May;20(3):461-6. 

A flexible partnership: the CytR anti-activator and the cAMP-CRP activator
protein, comrades in transcription control.

Valentin-Hansen P, Sogaard-Andersen L, Pedersen H.

Department of Molecular Biology, Odense University, Denmark.
Valentine@mol-bio.ou.dk

A vital point in gene regulation is control at the level of transcription
initiation. Recent research has established that this regulation can involve
sophisticated networks of interacting proteins that modulate the activity of the
transcription machinery by DNA looping, direct protein-protein interactions or
changing DNA topology in the promoter region. This Micro-Review focuses on our
investigations of a relatively simple prokaryotic gene regulatory system, the
Escherichia coli CytR regulon, which exhibits a number of these features. This
work has opened the door to the molecular understanding of how a prokaryotic
repressor can be correctly positioned at specific DNA sequences with the help of
a global activator, and how the repressor subsequently inhibits factor-dependent
transcription initiation.

Publication Types:
    Review
    Review, Tutorial

PMID: 8736525 [PubMed - indexed for MEDLINE]

208: J Bacteriol. 1996 Apr;178(8):2436-9. 

Analysis of the spacer DNA between the cyclic AMP receptor protein binding site
and the lac promoter.

Flatow U, Rajendrakumar GV, Garges S.

Developmental Genetics Section, Laboratory of Molecular Biology, National Cancer
Institute, Bethesda, Maryland 20892-4255, USA.

The role of the spacer region DNA between the cyclic AMP receptor protein (CRP)
site and the RNA polymerase in the lac promoter was examined. We wanted to
determine whether the wild-type DNA sequence of this region was an absolute
requirement for CRP activation of lac transcription. The sequence of a 9-bp
stretch of the spacer, from -41 to -49 relative to the start of transcription,
was randomized, and the effect of randomization on lac expression was
investigated in vitro and in vivo. We found that the spacer contains no specific
sequence determinants for CRP activation of lac transcription; fewer than 1% of
the mutants displayed greater than a 50% decrease in CRP activation of lac
transcription.

PMID: 8636052 [PubMed - indexed for MEDLINE]

209: Genes Cells. 1996 Mar;1(3):293-301. 

Mechanism responsible for glucose-lactose diauxie in Escherichia coli: challenge
to the cAMP model.

Inada T, Kimata K, Aiba H.

Department of Molecular Biology, School of Science, Nagoya University, Chikusa,
Japan.

BACKGROUND: The inhibition of beta-galactosidase expression in glucose-lactose
diauxie is a typical example of the glucose effect in Escherichia coli. It is
generally believed that glucose exerts its effect at least partly by reducing
the intracellular cAMP level. However, there is no direct evidence that the
inhibitory effect of glucose on the expression of the lac operon is mediated by
a reduction of the cAMP level in the glucose-lactose system. RESULTS: To examine
the roles of cAMP and the cAMP receptor protein (CRP) in the glucose effect, the
intracellular levels of these factors were determined during diauxic growth in a
glucose-lactose medium. We found that the levels of cAMP and CRP in a
lactose-grown phase were not higher than those in a glucose-grown phase,
although the cAMP levels increased transiently during the lag phase. The
addition of exogenous cAMP eliminated diauxic growth but did not eliminate
glucose repression. Glucose repression and diauxie were observed in cells which
lack cAMP but produce a cAMP-independent CRP. In addition, inactivation of the
lac repressor by the disruption of the lacI gene or the addition of IPTG,
eliminated glucose repression. CONCLUSION: We conclude that the repression of
beta-galactosidase expression by glucose is not due to the reduction of the
cAMP-CRP level but due to an inducer exclusion mechanism which is mediated by
the phosphoenolpyruvate-dependent sugar phosphotransferase system.

PMID: 9133663 [PubMed - indexed for MEDLINE]

210: J Bacteriol. 1996 Mar;178(6):1614-22. 

Analysis of CRP-CytR interactions at the Escherichia coli udp promoter.

Brikun I, Suziedelis K, Stemmann O, Zhong R, Alikhanian L, Linkova E, Mironov A,
Berg DE.

Department of Molecular Microbiology, Washington University Medical School, St.
Louis, Missouri 63110, USA.

Multiprotein complexes regulate the transcription of certain bacterial genes in
a sensitive, physiologically responsive manner. In particular, the transcription
of genes needed for utilization of nucleosides in Escherichia coli is regulated
by a repressor protein, CytR, in concert with the cyclic AMP (cAMP) activated
form of cAMP receptor protein (CRP). We studied this regulation by selecting and
characterizing spontaneous constitutive mutations in the promoter of the udp
(uridine phosphorylase) gene, one of the genes most strongly regulated by CytR.
We found deletions, duplications, and point mutations that affect key regulatory
sites in the udp promoter, insertion sequence element insertions that activated
cryptic internal promoters or provided new promoters, and large duplications
that may have increased expression by udp gene amplification. Unusual
duplications and deletions that resulted in constitutive udp expression that
depended on the presence of CytR were also found. Our results support the model
in which repression normally involves the binding of CytR to cAMP-CRP to form a
complex which binds to specific sites in the udp promoter, without direct
interaction between CytR protein and a specific operator DNA sequence, and in
which induction by specific inducer cytidine involves dissociation of CytR from
cAMP-CRP and the RNA polymerase interaction with cAMP-CRP bound to a site
upstream of then transcription start point. The stimulation of udp expression by
CytR in certain mutants may reflect its stabilization of cAMP-CRP binding to
target DNA and illustrates that only modest evolutionary changes could allow
particular multiprotein complexes to serve as either repressors or
transcriptional activators.

PMID: 8626289 [PubMed - indexed for MEDLINE]

211: Biochemistry. 1996 Jan 30;35(4):1162-72. 

Mode of selectivity in cyclic AMP receptor protein-dependent promoters in
Escherichia coli.

Pyles EA, Lee JC.

Department of Human Biological Chemistry and Genetics, University of Texas
Medical Branch, Galveston 77556-1055, USA.

Escherichia coli cAMP receptor protein (CRP) controls more than 20 genes. There
are significant differences in the promoter regions in these genes. Thus, an
elucidation of the mechanism of CRP action requires knowledge about the mode of
selectivity in these promoters. An earlier study [Heyduk, T., & Lee, J. C.
(1990) Proc. Natl. Acad. Sci. U.S.A. 81, 1744-8] indicates that the CRP(cAMP)1
conformer exhibits the highest affinity for the lac PI site in the lac operon.
It is conceivable that the CRP conformer that binds with the highest affinity to
these other sites may not be CRP(cAMP)1. To investigate this possibility, the
binding of CRP to nine CRP binding sites was studied as a function of cAMP
concentration. The CRP binding sites employed in this investigation were chosen
to represent the primary promoter sites from class I (lac site PI) and class II
(sites PI of gal and crp) as well as secondary CRP binding sites (crp site PII
and cat PII) to further understand the molecular mechanism of CRP in controlling
the transcription of these bacterial genes. The affinity of CRP for three
synthetic CRP binding sites was also examined to explore the contribution of the
inverted repeat region and sequences surrounding the recognition motifs. The
synthetic sequences are gallac which contains the lac recognition motifs in the
background of gal, modified cat PII which contains an 8-base pair spacer between
the recognition motifs rather than the 7-base pair sequence naturally found in
cat PII, and a random sequence that has no known similarity to any CRP binding
site found in nature. The apparent affinities of these sequences for CRP were
quantitatively determined to be biphasic in their cAMP dependence. The
CRP(cAMP)1 conformer was found to have the highest affinity for all of the DNA
sequences examined. No specific affinity was observed for these sequences with
free CRP and CRP(cAMP)2. The affinity of CRP for DNA was sequence-dependent and
increased in the following order: random < cat site PII, modified cat site PII,
crp sites PI and PII < gal site PI < lac site PI < gallac. These results
indicate that the entire CRP binding site sequence and its natural variability
provide information to CRP. These promoter sites which appear to have different
mechanisms at the molecular level are transcriptionally controlled by the same
CRP conformer, CRP(cAMP)1. Thus, the regulation of transcription by CRP is more
subtle than choosing different conformational forms of CRP. Using
"physiological" concentrations of various components, a computer simulation
study was conducted to illustrate the possible consequences of the thermodynamic
parameters determined in this study. It is evident that the promoters of protein
systems regulating the transport and metabolism of carbohydrates are responsive
to low cAMP concentrations. However, the promoter for controlling the expression
of CRP is highly regulated by the fluctuation of cAMP concentration.

PMID: 8573570 [PubMed - indexed for MEDLINE]

212: Biochimie. 1996;78(11-12):1035-42. 

Differential contributions of two elements of rho-independent terminator to
transcription termination and mRNA stabilization.

Abe H, Aiba H.

Department of Molecular Biology, School of Science, Nagaya University, Japan.

The hallmark features of rho-independent transcription terminators are a
G(+)C-rich dyad symmetry sequence followed by a run of T residues on a sense
strand. Both of these structural elements are required for efficient
transcription termination. Besides its primary function, rho-independent
terminators are also known to enhance expression of an upstream gene by
stabilizing RNA in a few cases. The Escherichia coli crp gene encoding cAMP
receptor protein (CRP) contains a typical rho-independent terminator. To gain
further insight into the roles of the G(+)C-rich dyad symmetry sequence and the
poly(T) tract both in transcription termination and mRNA stabilization, we
constructed a series of variant crp terminators and analyzed their abilities
regarding these two functions. Disruption of the G(+)C-rich dyad symmetry
sequence almost completely eliminated terminator activity while disruption of
the poly(T) tract reduced terminator activity significantly but not completely.
Thus, the contribution of the G(+)C-rich dyad symmetry sequence to transcription
termination is larger than that of the poly(T) tract. Disruption of the
G(+)C-rich dyad symmetry region reduced expression of the upstream crp gene by
accelerating the rate of mRNA degradation. However, disruption of the poly(T)
sequence had no effect on the stability of the crp mRNA, indicating that the
poly(T) tract plays no role in mRNA stabilization. When the crp terminator was
replaced by terminators derived from other genes, the fusion genes expressed the
crp mRNA at the same level as did the native crp gene, suggesting that the mRNA
stabilization effect is probably a general nature of rho-independent
terminators.

PMID: 9150882 [PubMed - indexed for MEDLINE]

213: J Bacteriol. 1995 Dec;177(24):7141-9. 

Expression and characterization of the Escherichia coli fdo locus and a possible
physiological role for aerobic formate dehydrogenase.

Abaibou H, Pommier J, Benoit S, Giordano G, Mandrand-Berthelot MA.

Laboratoire de Genetique Moleculaire des Microorganismes et des Interactions
Cellulaires, Institut National des Sciences Appliquees, Centre National de la
Recherche Scientifique URA 1486, Villeurbanne, France.

In the presence of nitrate, the major anaerobic respiratory pathway includes
formate dehydrogenase (FDH-N) and nitrate reductase (NAR-A), which catalyze
formate oxidation coupled to nitrate reduction. Two aerobically expressed
isoenzymes, FDH-Z and NAR-Z, have been recently characterized. Enzymatic
analysis of plasmid subclones carrying min 88 of the Escherichia coli chromosome
was consistent with the location of the fdo locus encoding FDH-Z between the
fdhD and fdhE genes which are necessary for the formation of both formate
dehydrogenases. The fdo locus produced three proteins (107, 34, and 22 kDa) with
sizes similar to those of the subunits of the purified FDH-N. In support to
their structural role, these polypeptides were recognized by antibodies specific
to FDH-N. Expression of a chromosomal fdo-uidA operon fusion was induced
threefold by aerobic growth and about twofold by anaerobic growth in the
presence of nitrate. However, it was independent of the two global regulatory
proteins FNR and ArcA, which control genes for anaerobic and aerobic functions,
respectively, and of the nitrate response regulator protein NARL. In contrast, a
mutation affecting either the nucleoid-associated H-NS protein or the CRP
protein abolished the aerobic expression. A possible role for FDH-Z during the
transition from aerobic to anaerobic conditions was examined. Synthesis of FDH-Z
was maximal at the end of the aerobic growth and remained stable after a shift
to anaerobiosis, whereas FDH-N production developed only under anaerobiosis.
Furthermore, in an fnr strain deprived of both FDH-N and NAR-A activities,
aerobically expressed FDH-Z and NAR-Z enzymes were shown to reduce nitrate at
the expense of formate under anaerobic conditions, suggesting that this pathway
would allow the cell to respond quickly to anaerobiosis.

PMID: 8522521 [PubMed - indexed for MEDLINE]

214: Mol Microbiol. 1995 Nov;18(3):521-31. 

Transcriptional co-activation at the ansB promoters: involvement of the
activating regions of CRP and FNR when bound in tandem.

Scott S, Busby S, Beacham I.

Faculty of Science and Technology, Griffith University, Nathan, Brisbane,
Queensland, Australia.

Previous work with semi-synthetic promoters containing a single CRP binding site
centred at 41.5 bp from the transcription start site has demonstrated enhanced
transcription (synergism) when a second binding site, for CRP or FNR, is placed
upstream at around -91 bp. The ansB promoter in Escherichia coli is co-activated
in a co-dependent manner by one dimer each of CRP and FNR protein whose binding
sites are at around -91 and -41 bp, respectively, from the transcription start
site. Similarly, the homologous ansB promoter in Salmonella is co-activated by
two dimers of CRP which function synergistically. The binding sites at the E.
coli promoter have been changed by mutation to provide a number of active
promoter derivatives carrying other combinations of FNR and CRP binding sites.
The co-dependent versus synergistic interaction of these activators and their
requirement for known activating regions have been examined. The results
demonstrate that FNR can co-activate when located upstream at around -91 bp in
combination with either FNR or CRP downstream. When FNR occupies the downstream
site the promoter is co-dependent on an upstream activator, but not when CRP
occupies this site. Activating region 1 in CRP (defined by substitutions at
residue H159) and its putative equivalent in FNR (defined by substitutions at
S73) are mainly required in the upstream activator; the putative equivalent in
FNR of activating region 3 of CRP (defined by substitutions at G85 and K52,
respectively) is mainly required in the dimer which binds downstream. Activating
region 1 of FNR is required only in the downstream subunit of the upstream
activator in a promoter which is co-dependent on two FNR dimers. These data
suggest that both bound upstream and downstream activators interact with RNA
polymerase to promote transcription, and that co-dependence is determined by the
nature of the activator plus the promoter context.

PMID: 8748035 [PubMed - indexed for MEDLINE]

215: Mol Microbiol. 1995 Oct;18(1):175-84. 

Regulatory characteristics and promoter analysis of csiE, a stationary
phase-inducible gene under the control of sigma S and the cAMP-CRP complex in
Escherichia coli.

Marschall C, Hengge-Aronis R.

Department of Biology, University of Konstanz, Germany.

Sigma-S and the cAMP-CRP complex are global regulatory factors involved in
stationary-phase induction of large groups of genes in Escherichia coli. csiE, a
gene located at 57.25 min (co-ordinate 2674) of the physical map of the E. coli
chromosome, is under the control of both of these factors. Sigma-S plays a
positive, though not absolutely essential, role in the expression of csiE.
Regulation by cAMP-CRP has both positive and negative elements, with the latter
being dependent on the presence of sigma s, whose expression is negatively
influenced by cAMP-CRP. csiE has a single transcriptional start site located 33
bp upstream of the initiation codon. By a 5'-deletion approach, we show that 72
bp upstream of the csiE transcriptional start site are sufficient for regulation
by sigma s and cAMP-CRP. A deletion upstream of nucleotide -38 with respect to
the start site eliminates positive cAMP-CRP control and makes the remaining
expression fully dependent on sigma S. Our results indicate that transcription
at the csiE promoter can be initiated in vivo by sigma S-containing RNA
polymerase alone as well as by sigma 70-containing RNA polymerase in conjunction
with cAMP-CRP or a cAMP-CRP-dependent secondary regulator. The promoter region
of poxB, the structural gene for pyruvate oxidase, which is also under the
control of sigma S and cAMP-CRP, is very similar to the corresponding region of
csiE, suggesting a similar regulatory mechanism also for poxB.

PMID: 8596457 [PubMed - indexed for MEDLINE]

216: Microbiology. 1995 Oct;141 ( Pt 10):2489-97. 

The CrP operon of Chlamydia psittaci and Chlamydia pneumoniae.

Watson MW, Clarke IN, Everson JS, Lambden PR.

University Medical School, Southampton General Hospital, UK.

One of the critical developmental events during the unique intracellular life
cycle of Chlamydiae is their differentiation from a metabolically active,
replicative form or reticulate body (RB) to an infectious extracellular form of
the organism (elementary body or EB). This process is characterized by the
expression of two extraordinarily cysteine-rich envelope proteins of molecular
masses 9 kDa and 60 kDa. We describe the molecular cloning and sequence
determination of the 9 kDa cysteine-rich proteins (CrPs) of C. pneumoniae and C.
psittaci. Comparison of these 9 kDa CrP amino acid sequences with those of C.
trachomatis showed regions of structural variation and conservation.
Transcription of the 9 kDa CrP genes occurred as both a monocistronic message
and as a bicistronic message which included the 60 kDa CrP gene. Transcription
of the 9 kDa and 60 kDa CrP genes was tightly linked to the chlamydial growth
cycle with synthesis of their mRNAs and consequent translation of the 60 kDa
CrPs occurring as RBs differentiated to form EBs. The maximal rate of
transcription occurred late in the growth cycle from a single but highly
conserved promoter which had close similarity with the Escherichia coli
consensus promoter sequences. A stem and loop structure which could be involved
in regulating translation of mRNA occurred in all three species between the
transcriptional start point and the ribosome binding site. Although
transcription is initiated from a single promoter in all three chlamydial
species, transcriptional termination points for the monocistronic and
bicistronic mRNAs differ in both number and position.

PMID: 7582008 [PubMed - indexed for MEDLINE]

217: Mol Microbiol. 1995 Sep;17(5):843-53. 

Gene-regulatory modules in Escherichia coli: nucleoprotein complexes formed by
cAMP-CRP and CytR at the nupG promoter.

Pedersen H, Dall J, Dandanell G, Valentin-Hansen P.

Department of Molecular Biology, Odense University, Denmark.

Repression by CytR depends on the formation of nucleoprotein complexes in which
the CytR repressor and the cAMP-CRP activator complex bind co-operatively to the
DNA. Transcription initiation from CytR-regulated promoters requires cAMP-CRP;
therefore, the cAMP-CRP complex functions both as an activator and as a
co-repressor in these promoters. Another interesting aspect of the CytR regulon
is that each promoter appears to have individual features. Therefore, structural
and functional rules governing the formation of repression and activation
complexes in one promoter may not be valid for other promoters of the CytR
regulon. Here we show that the Escherichia coli nupG gene contains one CytR- and
four CRP-binding sites in the control region. Notably, the architecture of the
CytR binding site is different from previously described targets. In addition,
the CytR repressor triggers a DNA repositioning of a cAMP-CRP complex in the -35
region upon binding to its operator. Thus, formation of the repression and
activation complexes at the nupG promoter involves different subsets of
CRP-binding sites. These findings show that the bacterium uses positive and
negative regulatory modules to differentially control the expression of CytR-
and cAMP-CRP-regulated genes.

PMID: 8596434 [PubMed - indexed for MEDLINE]

218: Biochemistry. 1995 Aug 29;34(34):10816-26. 

Probing the mechanism of CRP activation by site-directed mutagenesis: the role
of serine 128 in the allosteric pathway of cAMP receptor protein activation.

Cheng X, Kovac L, Lee JC.

Department of Human Biological Chemistry and Genetics, University of Texas
Medical Branch at Galveston 77555, USA.

Upon activation by cAMP, Escherichia coli cAMP receptor protein (CRP) controls
the expression of a network of catabolite sensitive genes. The activation of CRP
by cAMP involves conformational changes such as realignments between subunits
and domains within the protein. To understand the molecular events that lead to
the activation of CRP, point mutations at position 128 were introduced via
site-directed mutagenesis in an attempt to specifically affect the subunit
interfacial interactions, as well as the ligand-binding reaction. The
biochemical and biophysical properties of these mutants were rigorously tested
with the goal of identifying the partial reactions in the activation pathway
that are perturbed by this specific mutation. Results from this study suggest
that mutation of Ser 128 to Ala or Pro does not significantly disturb the
overall secondary structure as monitored by circular dichroism. The energetics
of subunit-subunit interaction and protein stability were monitored by
sedimentation and spectroscopic techniques. Although these mutants were designed
to interrupt intersubunit interactions, the energetics of subunit association
and protein stability remain quantitatively the same as those of the wild-type
CRP. Nevertheless, the ability of the subunit to be realigned to the DNA-binding
form is significantly affected as reflected by the pronounced decrease in the
susceptibility of mutant CRP to proteolytic digestion in the presence of cAMP.
In addition, the binding affinity of cAMP to the first ligand site in mutants
S128A and S128P is the same as that of the wild type, but the affinity to the
second ligand site is reduced. This observation indicates that mutation at
position 128 affects ligand binding by amplifying the magnitude of negative
cooperativity. Mutation at residue 128 does not impair the ability of
interdomain interactions as indicated by the quantitative response of a
spectroscopic probe in the DNA-binding domain to the binding of cAMP to the
ligand-binding domain. The S128A mutant binds to a specific DNA sequence about
50-fold weaker than the wild-type CRP, while the mutant S128P has no measurable
DNA affinity under the same conditions. This observation is consistent with the
in vivo result that both mutants display an inactive CRP phenotype (CRP-). In
summary, these results suggest that communication between domains induced by
cAMP binding can be dissociated from the proper subunit realignment of the CRP
dimer that is crucial for the activation of CRP.(ABSTRACT TRUNCATED AT 400
WORDS)

PMID: 7662661 [PubMed - indexed for MEDLINE]

219: FEBS Lett. 1995 Aug 28;371(1):73-6. 

Expression of the nir and nor genes for denitrification of Pseudomonas
aeruginosa requires a novel CRP/FNR-related transcriptional regulator, DNR, in
addition to ANR.

Arai H, Igarashi Y, Kodama T.

Department of Biotechnology, University of Tokyo, Japan.

A gene, designated dnr, was identified in the vicinity of the structural genes
for nitrite reductase (nirS) and nitric oxide reductase (norCB), and the gene
for activation of the reductases (nirQ) from Pseudomonas aeruginosa. It encodes
a protein of 227 amino acids homologous with the CRP/FNR-family transcriptional
regulators. Promoter activities for nirS, nirQ and norCB were considerably
reduced in the dnr mutant as well as in the mutant of anr, the other fnr-like
regulatory gene from P. aeruginosa. This is the first finding that two
CRP/FNR-related regulators are involved in denitrification in one strain.

PMID: 7664887 [PubMed - indexed for MEDLINE]

220: Comput Appl Biosci. 1995 Aug;11(4):379-87. 

Identification of common motifs in unaligned DNA sequences: application to
Escherichia coli Lrp regulon.

Fraenkel YM, Mandel Y, Friedberg D, Margalit H.

Department of Molecular Genetics, Hebrew University-Hadassah Medical School,
Jerusalem, Israel.

We describe a relatively simple method for the identification of common motifs
in DNA sequences that are known to share a common function. The input sequences
are unaligned and there is no information regarding the position or orientation
of the motif. Often such data exists for protein-binding regions, where genetic
or molecular information that defines the binding region is available, but the
specific recognition site within it is unknown. The method is based on the
principle of 'divide and conquer'; we first search for dominant submotifs and
then build full-length motifs around them. This method has several useful
features: (i) it screens all submotifs so that the results are independent of
the sequence order in the data; (ii) it allows the submotifs to contain spacers;
(iii) it identifies an existing motif even if the data contains 'noise'; (iv)
its running time depends linearly on the total length of the input. The method
is demonstrated on two groups of protein-binding sequences: a well-studied group
of known CRP-binding sequences, and a relatively newly identified group of genes
known to be regulated by Lrp. The Lrp motif that we identify, based on 23 gene
sequences, is similar to a previously identified motif based on a smaller data
set, and to a consensus sequence of experimentally defined binding sites.
Individual Lrp sites are evaluated and compared in regard to their regulation
mode.

PMID: 8521047 [PubMed - indexed for MEDLINE]

221: Mol Gen Genet. 1995 Jul 22;248(1):1-8. 

Mutational analysis of the role of the first helix of region 4.2 of the sigma 70
subunit of Escherichia coli RNA polymerase in transcriptional activation by
activator protein PhoB.

Kim SK, Makino K, Amemura M, Nakata A, Shinagawa H.

Department of Molecular Microbiology, Osaka University, Japan.

Transcription of the genes belonging to the phosphate (pho) regulon in
Escherichia coli requires the specific activator protein PhoB, in addition to
RNA polymerase containing the major sigma factor, sigma 70, which is encoded by
rpoD. We previously isolated two mutant sigma 70s (D570G and E575K) that were
specifically defective in transcribing the pho genes. The mutated sites were
located near and within the first helix of the helix-turn-helix (HTH) motif or
region 4.2 of sigma 70. To study further the role of the first helix of the HTH
motif of sigma 70 in transcriptional activation by PhoB, we made a series of
rpoD mutations that alter the motif and purified the mutant sigma 70 proteins.
RNA polymerases containing the mutant sigma 70s Y571A, T572L, V576T, K578E and
F580V showed reduced in vitro transcription from the pstS promoter, a
representative pho promoter, in the presence of PhoB, whereas RNA polymerase
containing another mutant sigma 70 (E574K) showed enhanced transcription from
the promoter. Transcription from the activator-independent tac promoter and the
pBR-P4 promoter, which is independent of PhoB and requires cAMP-CRP (cAMP
receptor protein) for transcription, was affected at most only marginally by
these sigma 70 mutations. These results provide further evidence that the first
helix plays an important role in the specific interaction between RNA polymerase
and PhoB protein bound to the pho promoters in transcriptional activation.

PMID: 7651320 [PubMed - indexed for MEDLINE]

222: Mol Microbiol. 1995 Jul;17(2):251-8. 

Glucose lowers CRP* levels resulting in repression of the lac operon in cells
lacking cAMP.

Tagami H, Inada T, Kunimura T, Aiba H.

Department of Molecular Biology, School of Science, Nagoya University, Japan.

CRP-cAMP-dependent operons of Escherichia coli can be expressed in cells lacking
functional adenylate cyclase when they carry a second-site mutation in the crp
gene (crp*). It is known that the expression of these operons is repressed by
glucose, but the molecular mechanism underlying this cAMP-independent catabolite
repression has been a long-standing mystery. Here we address the question of how
glucose inhibits the expression of beta-galactosidase in the absence of cAMP. We
have isolated several mutations in the crp gene that confer a CRP* phenotype.
The expression of beta-galactosidase is reduced by glucose in cells carrying
these mutations. Using Western blotting and/or SDS-PAGE analysis, we demonstrate
that glucose lowers the cellular concentration of CRP* through a reduction in
crp* mRNA levels. The level of CRP* protein correlates with beta-galactosidase
activity. When the crp promoter is replaced with the bla promoter, the
inhibitory effect of glucose on crp* expression is virtually abolished. These
data strongly suggest that the lowered level of CRP* caused by glucose mediates
catabolite repression in cya- crp* cells and that the autoregulatory circuit of
the crp gene is involved in the down-regulation of CRP* expression by glucose.

PMID: 7494474 [PubMed - indexed for MEDLINE]

223: J Bacteriol. 1995 Jun;177(11):3166-75. 

aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde
dehydrogenase that is repressed by Fis and activated by Crp.

Xu J, Johnson RC.

Department of Biological Chemistry, UCLA School of Medicine 90095, USA.

Escherichia coli aldB was identified as a gene that is negatively regulated by
Fis but positively regulated by RpoS. The complete DNA sequence determined in
this study indicates that aldB encodes a 56.3-kDa protein which shares a high
degree of homology with an acetaldehyde dehydrogenase encoded by acoD of
Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio
cholerae and significant homology with a group of other aldehyde dehydrogenases
from prokaryotes and eukaryotes. Expression of aldB is maximally induced during
the transition from exponential phase to stationary phase. Its message levels
are elevated three- to fourfold by a fis mutation and abolished by an rpoS
mutation. In addition, the expression of an aldB-lacZ fusion was decreased about
20-fold in the absence of crp. DNase I footprinting analysis showed that five
Fis binding sites and one Crp binding site are located within the aldB promoter
region, suggesting that Fis and Crp are acting directly to control aldB
transcription. AldB expression is induced by ethanol, but in contrast to that of
most of the RpoS-dependent genes, the expression of aldB is not altered by an
increase in medium osmolarity.

PMID: 7768815 [PubMed - indexed for MEDLINE]

224: Biochem Biophys Res Commun. 1995 May 25;210(3):938-47. 

Nucleotide sequence and functional analysis of regulatory region of the lumP and
the lux operon from Photobacterium leiognathi.

Lin JW, Chao YF, Weng SF.

Institute of Molecular Biology, National Chung Hsing University, Taichung,
Taiwan, ROC.

The lumP gene is linked to the lux operon, but runs in the opposite direction in
Photobacterium leiognathi PL741. The gene order of the lumP and the lux operon
is < -lumP-R & R-luxC-luxD-luxA-luxB-luxN-luxE- > (R & R: regulatory region).
The nucleotide sequence of the regulatory region (827-bp) between the lumP and
the lux operon was determined. Sequence analysis illustrates that the regulatory
region includes two divergent promoter systems, PR-promoter system for the lux
operon (R-operon) and PL-promoter system for the lumP or lum operon (L-operon).
Functional analysis of the regulatory region shows that the PR- and PL-promoter
systems both are able to lead the gene expression. The deletion experiment
result elicits that the PR- and PL-promoter are coordinatively and negatively
regulated; the PR- and PL-promoter might be competing for recognition by RNA
polymerase to initiate transcription. The fact of the LumP responsible for the
spectral blue shift in P. leiognathi implied that the lumP gene closedly linked
to the lux operon is for coordinative regulation with the lux operon. In
addition, the glucose repression on the PR-promoter system shows that the
expression of the lux operon is regulated by cAMP-CRP induction in E. coli.

PMID: 7763266 [PubMed - indexed for MEDLINE]

225: J Bacteriol. 1995 May;177(9):2335-42. 

Transcriptional control of the nuo operon which encodes the energy-conserving
NADH dehydrogenase of Salmonella typhimurium.

Archer CD, Elliott T.

Department of Microbiology, University of Alabama at Birmingham 35294, USA.

The 14 nuo genes encode the subunits of the type I (energy-conserving) NADH
dehydrogenase, a key component of the respiratory chain. Salmonella typhimurium,
like Escherichia coli, has two enzymes that can oxidize NADH and transfer
electrons to ubiquinone, but only the type I enzyme translocates protons across
the membrane to generate a proton motive force. Cells with the type I enzyme are
energetically more efficient; the role of the type II enzyme (encoded by ndh) is
not established, but it may function like a relief valve to allow more rapid
NADH recycling. Here, we have investigated transcription of the nuo gene
cluster, primarily in S. typhimurium. Studies with polar insertion mutants
demonstrate that these genes are arranged as a single, large operon that is
expressed from a complex promoter region upstream of nuoA. The DNA sequence of
the promoter region was determined, and primer extension analysis of nuo
transcripts was used to map four major RNA 5' ends to this region. A set of lac
operon fusions to various DNA segments from the nuo promoter region was also
constructed. Analysis of these fusions confirmed the presence of at least two
nuo promoters. Mutations in the global regulatory genes arcA, oxrA (fnr), crp,
cya, and katF were tested for effects on expression of the nuo operon. However,
none of the mutations tested had a large effect on expression of type I NADH
dehydrogenase.

PMID: 7730262 [PubMed - indexed for MEDLINE]

226: J Bacteriol. 1995 Apr;177(8):2157-63. 

Carbon monoxide-induced activation of gene expression in Rhodospirillum rubrum
requires the product of cooA, a member of the cyclic AMP receptor protein family
of transcriptional regulators.

Shelver D, Kerby RL, He Y, Roberts GP.

Department of Bacteriology, University of Wisconsin-Madison 53706.

Induction of the CO-oxidizing system of the photosynthetic bacterium
Rhodospirillum rubrum is regulated at the level of gene expression by the
presence of CO. In this paper, we describe the identification of a gene that is
required for CO-induced gene expression. An 11-kb deletion of the region
adjacent to the previously characterized cooFSCTJ region resulted in a mutant
unable to synthesize CO dehydrogenase in response to CO and unable to grow
utilizing CO as an energy source. A 2.5-kb region that corresponded to a portion
of the deleted region complemented this mutant for its CO regulation defect,
restoring its ability to grow utilizing CO as an energy source. When the 2.5-kb
region was sequenced, one open reading frame, designated cooA, predicted a
product showing similarity to members of the cyclic AMP receptor protein (CRP)
family of transcriptional regulators. The product, CooA, is 28% identical (51%
similar) to CRP and 18% identical (45% similar) to FNR from Escherichia coli.
The insertion of a drug resistance cassette into cooA resulted in a mutant that
could not grow utilizing CO as an energy source. CooA contains a number of
cysteine residues substituted at, or adjacent to, positions that correspond to
residues that contact cyclic AMP in the crystal structure of CRP. A model based
on this observation is proposed for the recognition of CO by Cooa. Adjacent to
cooA are two genes, nadB and nadC, with predicted products similar to proteins
in other bacteria that catalyze reactions in the de novo synthesis of
NAD.(ABSTRACT TRUNCATED AT 250 WORDS)

PMID: 7721706 [PubMed - indexed for MEDLINE]

227: Mol Microbiol. 1995 Apr;16(1):121-9. 

Differential expression of mal genes under cAMP and endogenous inducer control
in nutrient-stressed Escherichia coli.

Notley L, Ferenci T.

Department of Microbiology G08, University of Sydney, New South Wales,
Australia.

LamB glycoporin has an important general role in carbohydrate uptake during
growth at low extracellular sugar concentrations. lamB and mal regulon induction
during glucose starvation and glucose-limited continuous culture was
investigated using lacZ fusions. A low-level burst of lamB induction occurred
upon entry into glucose starvation-induced stationary phase but returned to
basal levels during continued nutrient deprivation. Glucose-limited continuous
culture elicited much higher expression of transporter genes in the mal regulon,
as well as [14C]-maltose-transport activity; malEFG and malKlamB operons in
glucose-limited chemostats were expressed to close to half of the level of
maltose-induced batch cultures. Limitation-induced expression was dependent on
both Crp-cAMP and MalT activation but was independent of RpoS function. As
expected for a gene with a Crp-controlled promoter, malT expression was maximal
under conditions which elicited the highest cAMP levels, but lamB induction did
not behave in a corresponding fashion. Rather, maximal lamB induction occurred
at rapid but suboptimal growth rates with micromolar or submicromolar medium
glucose. Maximal transport and lamB induction coincided with increased
endogenous maltotriose (inducer) concentrations during growth on glucose. Hence
regulation of glycoporin and the maltose-transport system is not a starvation-
or stationary-phase response but facilitates the adaptation of Escherichia coli
to low-nutrient environments through endoinduction.

PMID: 7651130 [PubMed - indexed for MEDLINE]

228: Nucleic Acids Res. 1995 Feb 25;23(4):599-605. 

Role of CRP in transcription activation at Escherichia coli lac promoter: CRP is
dispensable after the formation of open complex.

Tagami H, Aiba H.

Department of Molecular Biology, School of Science, Nagoya University, Japan.

The role of cAMP receptor protein (CRP) in transcription activation at the
Escherichia coli lac promoter was investigated focusing on the steps after the
formation of open complex. Although CRP binding to the lac DNA is stabilized in
the ternary open complex, a high concentration of heparin dissociates CRP from
the open complex without affecting the interaction between RNA polymerase and
promoter, resulting in a binary complex. The release of CRP is directly shown by
Western blotting and DNase I footprinting. The binary complex exhibits a
slightly increased gel mobility compared to the ternary complex. The binary
complex retains the characteristics of the open complex in footprinting pattern
which is essentially identical with that of the open complex of the lac UV5
promoter. The binary complex is competent for transcription. These results
indicate that CRP is not necessary for the maintenance of active open complex.
In addition, the removal of CRP does not increase the production of abortive
RNAs. We conclude that the contact between CRP and RNA polymerase is not
essential for transcription activation after the formation of the open complex
at the lac promoter. In other words, the role of CRP in the lac promoter is
restricted to the steps up to the formation of open complex.

PMID: 7899079 [PubMed - indexed for MEDLINE]

229: J Biol Chem. 1995 Feb 10;270(6):2489-96. 

Effect of the FruR regulator on transcription of the pts operon in Escherichia
coli.

Ryu S, Ramseier TM, Michotey V, Saier MH Jr, Garges S.

Laboratory of Molecular Biology, NCI, National Institutes of Health, Bethesda,
Maryland 20892-4255.

The promoters of the pts operon of Escherichia coli are controlled by the cyclic
AMP receptor protein (CRP) complexed with cAMP (CRP.cAMP). In addition, glucose
stimulates pts operon expression in vivo. The pts promoter region has a fructose
repressor (FruR)-binding site (the FruR box) that partially overlaps with one of
the CRP.cAMP-binding sites. The effects of the pleiotropic transcriptional
regulator FruR on pts operon expression were studied to determine whether the in
vivo glucose effect on pts operon expression is mediated by FruR. In vitro, FruR
can repress P1b transcription, which is activated by CRP.cAMP, and restore P1a
transcription, which is repressed by CRP.cAMP. FruR can displace CRP.cAMP from
its binding site in the presence of RNA polymerase even though FruR and CRP.cAMP
can bind simultaneously to their partially overlapping binding sites in the
absence of RNA polymerase. FruR had very little effect on the transcription of
the P0 promoter, which is most important for regulation by glucose. Consistent
with the in vitro results, pts P0 transcription did not increase as much in
cells grown in the presence of fructose or in fruR- mutant cells as in cells
grown in the presence of glucose. These results suggest that FruR alone does not
mediate the in vivo glucose effect on pts operon expression.

PMID: 7852310 [PubMed - indexed for MEDLINE]

230: Mol Microbiol. 1995 Feb;15(3):473-82. 

Regulation of succinate dehydrogenase (sdhCDAB) operon expression in Escherichia
coli in response to carbon supply and anaerobiosis: role of ArcA and Fnr.

Park SJ, Tseng CP, Gunsalus RP.

Department of Microbiology and Molecular Genetics, University of California, Los
Angeles 90024, USA.

Succinate dehydrogenase (SDH) of Escherichia coli, the sole membrane-bound
enzyme of the tricarboxylic acid cycle, participates in the aerobic
electron-transport pathway to generate energy via oxidative phosphorylation
reactions. Previous studies have established that succinate dehydrogenase (SDH)
synthesis is elevated by aerobiosis and suppressed during growth with glucose.
To examine how the sdhCDAB genes that encode SDH are regulated by changes in the
environment, sdh-lacZ fusions were constructed and analysed in vivo following
cell growth under a variety of alternative culture conditions. Expression of
sdh-lacZ was highest under aerobic conditions and was decreased 10-fold in the
absence of oxygen. The fnr and arcA gene products are required for this oxygen
control and each acts to repress sdhC-lacZ expression. Expression of sdh-lacZ
also varied 10- to 14-fold depending on the type of carbon substrate used or the
medium richness. This control was shown to be independent of the crp and fruR
gene products, and indicates that some other regulatory element exists in the
cell to adjust SDH enzyme levels accordingly. Iron and haem availability
affected sdhC-lacZ expression by two- to three-fold. Lastly, sdhC-lacZ
expression was shown to vary with the cell growth rate during aerobic and
anaerobic conditions.

PMID: 7783618 [PubMed - indexed for MEDLINE]

231: Chin J Biotechnol. 1995;11(2):87-92. 

The regulation of pac gene expression by CRP and FNR.

Jiang L, Yang S.

Shanghai Research Center of Biotechnology, Chinese Academy of Sciences, China.

The expression of pac gene is under the regulation of many factors. The
mechanisms of glucose and oxygen regulation have been studied. It was found that
FNR showed no effect on the expression of pac, and CRP activated the expression
of pac. The possible binding site of CRP was found to be located upstream to the
pac promoter.

PMID: 8562853 [PubMed - indexed for MEDLINE]

232: J Basic Microbiol. 1995;35(4):217-27. 

The fix Escherichia coli region contains four genes related to carnitine
metabolism.

Eichler K, Buchet A, Bourgis F, Kleber HP, Mandrand-Berthelot MA.

Laboratoire de Genetique Moleculaire des Microorganismes et des Interactions
Cellulaires, CNRS URA 1486, Villeurbanne, France.

Anaerobic carnitine metabolism in Escherichia coli was recently shown to involve
six genes organized in the cai operon and located at the first minute on the
chromosome. The DNA sequence lying at the 5' end of the cai locus was further
investigated. It contains four open reading frames organized as an operon. In
vivo overexpression of this DNA region revealed four polypeptides with apparent
molecular masses of 27, 33, 45 and 6 kDa. These proteins displayed significant
amino acid sequence homologies with polypeptides encoded by the fixABCX operons
from Azorhizobium caulinodans and Rhizobium meliloti. The four ORFs were thus
named fixABCX. The first two gene products were also found to share a high
degree of sequence similarity with the subunits beta and alpha, respectively, of
mammalian electron transfer flavoproteins, suggesting a role for these proteins
in a redox reaction. A singly polycistronic 5 kb mRNA transcript was detected in
Northern blots under anaerobic conditions in the presence of DL-carnitine.
Expression of a fixA-lacZ transcriptional fusion was induced by L(-)-carnitine
and crotonobetaine but not by D(+)-carnitine, gamma-butyrobetaine,
glycinebetaine and choline as found previously for the carnitine pathway.
Similarly, the fix operon was repressed by glucose and nitrate. Moreover,
expression of the fix operon was induced by the global regulatory proteins CRP
and FNR and repressed by the histone-like protein H-NS. All these regulatory
proteins have been shown also to control expression of carnitine enzymes.
Results from Northern blots and lacZ fusion studies indicate a common regulation
of expression of fix and cai operons, which implies a physiological linkage
between these two loci.

PMID: 7473063 [PubMed - indexed for MEDLINE]

233: Proc Natl Acad Sci U S A. 1994 Dec 20;91(26):12619-23. 

Erratum in:
    Proc Natl Acad Sci U S A 1995 Apr 11;92(8):3631.

Synergistic binding of the Vibrio fischeri LuxR transcriptional activator domain
and RNA polymerase to the lux promoter region.

Stevens AM, Dolan KM, Greenberg EP.

Department of Microbiology, University of Iowa, Iowa City 52242.

LuxR, the Vibrio fischeri luminescence gene (lux) activator, is the best-studied
member of a family of bacterial transcription factors required for cell
density-dependent expression of specific genes involved in associations with
eukaryotic hosts. Neither LuxR nor any other LuxR homolog has been shown to bind
DNA directly. We have purified the LuxR C-terminal transcriptional activator
domain from extracts of recombinant Escherichia coli in which this polypeptide
was expressed. The purified polypeptide by itself binds to lux regulatory DNA
upstream of the lux box, a 20-bp palindrome that is required for LuxR activity
in vivo, but it does not bind to the lux box. However, the LuxR C-terminal
domain together with RNA polymerase protects a region including the lux box and
the lux operon promoter from DNase I cleavage. There is very little protection
of the lux operon promoter region from DNase I digestion in the presence of RNA
polymerase alone. Apparently, there is a synergistic binding of the LuxR
C-terminal domain and RNA polymerase to the promoter region. The upstream
binding region for the purified polypeptide encompasses a binding site for cAMP
receptor protein (CRP). Under some conditions, CRP binding can block the binding
of the LuxR C-terminal domain to the upstream binding region, and it can also
block the synergistic binding of the LuxR C-terminal domain and RNA polymerase
to the lux box and luminescence gene promoter region. This description of DNA
binding by the LuxR C-terminal domain should lead to an understanding of the
molecular interactions of the LuxR family of transcriptional activators with
regulatory DNA.

PMID: 7809088 [PubMed - indexed for MEDLINE]

234: Mol Microbiol. 1994 Dec;14(5):989-97. 

The gene encoding the periplasmic cyclophilin homologue, PPIase A, in
Escherichia coli, is expressed from four promoters, three of which are activated
by the cAMP-CRP complex and negatively regulated by the CytR repressor.

Norregaard-Madsen M, Mygind B, Pedersen R, Valentin-Hansen P, Sogaard-Andersen
L.

Department of Molecular Biology, Odense University, Denmark.

The rot gene in Escherichia coli encodes PPIase A, a periplasmic peptidyl-prolyl
cis-trans isomerase with homology to the cyclophilin family of proteins. Here it
is demonstrated that rot is expressed in a complex manner from four overlapping
promoters and that the rot regulatory region is unusually compact, containing a
close array of sites for DNA-binding proteins. The three most upstream rot
promoters are activated by the global gene regulatory cAMP-CRP complex and
negatively regulated by the CytR repressor protein. Activation of these three
promoters occurs by binding of cAMP-CRP to two sites separated by 53 bp.
Moreover, one of the cAMP-CRP complexes is involved in the activation of both a
Class I and a Class II promoter. Repression takes place by the formation of a
CytR/cAMP-CRP/DNA nucleoprotein complex consisting of the two cAMP-CRP molecules
and CytR bound in between. The two regulators bind co-operatively to the DNA
overlapping the three upstream promoters, simultaneously quenching the cAMP-CRP
activator function. These results expand the CytR regulon to include a gene
whose product has no known function in ribo- and deoxyribonucleoside catabolism
or transport.

PMID: 7715459 [PubMed - indexed for MEDLINE]

235: Microbiology. 1994 Oct;140 ( Pt 10):2531-41. 

Two genetically-distinct and differentially-regulated aconitases (AcnA and AcnB)
in Escherichia coli.

Gruer MJ, Guest JR.

Krebs Institute for Biomolecular Research, Department of Molecular Biology and
Biotechnology, University of Sheffield, UK.

An acnA mutant of Escherichia coli was constructed by replacing the chromosomal
acnA gene by an internally deleted derivative containing a kanR cassette.
Southern and Western blotting confirmed that the acnA gene had been replaced by
the disrupted gene and that the aconitase A protein was no longer expressed.
However, the mutant failed to exhibit the anticipated glutamate auxotrophy and
it retained a residual aconitase activity. This activity was due to an analogous
unstable enzyme(s) designated aconitase B. Studies on the regulation of
aconitase A synthesis using an acnA-lacZ translational fusion showed that the
acnA gene resembles other citric acid cycle genes in being subject to
CRP-mediated catabolite repression and ArcA-mediated anaerobic repression. In
addition to being activated by the SoxRS oxidative stress regulatory system, the
acnA gene appeared to be activated by the ferric uptake regulator (Fur). It was
concluded that the acnA gene belongs to at least four global regulatory
networks, crp, arcA, fur and soxRS. In contrast, the aconitase B activity
decreased after exposure to oxidative stress and was less affected by
anaerobiosis. Comparable studies with the fumarase genes (fumA, B and C)
indicated that fumA (encoding the unstable aerobic iron-sulphur-containing
fumarase) is activated by the ferric uptake regulator (Fur) and fumC (encoding
the stable fumarase) is activated by the SoxRS oxidative stress regulatory
system.

PMID: 8000525 [PubMed - indexed for MEDLINE]

236: J Bacteriol. 1994 Sep;176(17):5474-82. 

The control region of the pdu/cob regulon in Salmonella typhimurium.

Chen P, Andersson DI, Roth JR.

Department of Biology, University of Utah, Salt Lake City 84112.

The pdu operon encodes proteins for the catabolism of 1,2-propanediol; the
nearby cob operon encodes enzymes for the biosynthesis of adenosyl-cobalamin
(vitamin B12), a cofactor required for the use of propanediol. These operons are
transcribed divergently from distinct promoters separated by several kilobases.
The regulation of the two operons is tightly integrated in that both require the
positive activator protein PocR and both are subject to global control by the
Crp and ArcA proteins. We have determined the DNA nucleotide sequences of the
promoter-proximal portion of the pdu operon and the region between the pdu and
cob operons. Four open reading frames have been identified, pduB, pduA, pduF,
and pocR. The pduA and pduB genes are the first two genes of the pdu operon
(transcribed clockwise). The pduA gene encodes a hydrophobic protein with 56%
amino acid identity to a 10.9-kDa protein which serves as a component of the
carboxysomes of several photosynthetic bacteria. The pduF gene encodes a
hydrophobic protein with a strong similarity to the GlpF protein of Escherichia
coli, which facilitates the diffusion of glycerol. The N-terminal end of the
PduF protein includes a motif for a membrane lipoprotein-lipid attachment site
as well as a motif characteristic of the MIP (major intrinsic protein) family of
transmembrane channel proteins. We presume that the PduF protein facilitates the
diffusion of propanediol. The pocR gene encodes the positive regulatory protein
of the cob and pdu operons and shares the helix-turn-helix DNA binding motif of
the AraC family of regulatory proteins. The mutations cobR4 and cobR58 cause
constitutive, pocR-independent expression of the cob operon under both aerobic
and anaerobic conditions. Evidence that each mutation is a deletion creating a
new promoter near the normal promoter site of the cob operon is presented.

PMID: 8071226 [PubMed - indexed for MEDLINE]

237: Proc Natl Acad Sci U S A. 1994 Aug 30;91(18):8582-6. 

Erratum in:
    Proc Natl Acad Sci U S A. 1994 Nov 8;91(23):11281.

An arcane role of DNA in transcription activation.

Ryu S, Garges S, Adhya S.

Laboratory of Molecular Biology, National Cancer Institute, National Institutes
of Health, Bethesda, MD 20892.

The mechanism by which the cAMP receptor protein (CRP) activates transcription
has been investigated using the lac promoter of Escherichia coli. For
transcription activation, an interaction between DNA-bound CRP and RNA
polymerase is not sufficient. CRP must bind to a site in the same DNA and close
to the promoter. CRP action requires an intact spacer DNA to provide a rigid
support in building a CRP-RNA polymerase protein bridge or to allow a
conformational change in the DNA to be transmitted to the lac promoter using the
protein bridge as a structural support.

PMID: 7811325 [PubMed - indexed for MEDLINE]

238: J Bacteriol. 1994 Aug;176(16):5086-92. 

Regulation of the citrate synthase (gltA) gene of Escherichia coli in response
to anaerobiosis and carbon supply: role of the arcA gene product.

Park SJ, McCabe J, Turna J, Gunsalus RP.

Department of Microbiology and Molecular Genetics, University of California, Los
Angeles 90024.

As an enzyme of the tricarboxylic acid cycle pathway, citrate synthase
participates in the generation of a variety of cellular biosynthetic
intermediates and in that of reduced purine nucleotides that are used in energy
generation via electron transport-linked phosphorylation reactions. It catalyzes
the condensation of oxaloacetate and acetyl coenzyme A to produce citrate plus
coenzyme A. In Escherichia coli this enzyme is encoded by the gltA gene. To
investigate how gltA expression is regulated, a gltA-lacZ operon fusion was
constructed and analyzed following aerobic and anaerobic cell growth on various
types of culture media. Under aerobic culture conditions, expression was
elevated to a level twofold higher than that reached under anaerobic culture
conditions. ArcA functions as a repressor of gltA expression under each set of
conditions: in a delta arcA strain, gltA-lacZ expression was elevated to levels
two- and eightfold higher than those seen in a wild-type strain under aerobic
and anaerobic conditions, respectively. This control is independent of the fnr
gene product, an alternative anaerobic gene regulator in E. coli. When the
richness or type of carbon compound used for cell growth was varied, gltA-lacZ
expression varied by 10- to 14-fold during aerobic and anaerobic growth. This
regulation was independent of both the crp and fruR gene products, suggesting
that another regulatory element in E. coli is responsible for the observed
control. Finally, gltA-lacZ expression was shown to be inversely proportional to
the cell growth rate. These findings indicate that the regulation of gltA gene
expression is complex in meeting the differential needs of the cell for
biosynthesis and energy generation under various cell culture conditions.

PMID: 8051021 [PubMed - indexed for MEDLINE]

239: Biochem Biophys Res Commun. 1994 Jul 15;202(1):535-42. 

Oxygen dependent regulation of Vitreoscilla globin gene: evidence for positive
regulation by FNR.

Joshi M, Dikshit KL.

Institute of Microbial Technology, Chandigarh, India.

Vitreoscilla globin (vgb) gene, encoding for Vitreoscilla haemoglobin (VtHb) has
been cloned and functionally expressed in heterologous bacterial hosts. Analysis
of vgb gene expression and the study on vgb-xylE transcriptional fusion revealed
that vgb promoter is preferentially activated in response to oxygen limitation
in Vitreoscilla and other heterologous bacterial hosts. Microaerobic mode of
induction in various hosts, provided evidence for a common regulatory factor
involved in activation of vgb promoter under hypoxic condition. Primary
structure analysis of vgb upstream regulatory region indicated the presence of a
possible binding site for the transcriptional activator, FNR. Further, the
E.coli mutant lacking fnr gene product was not able to activate vgb promoter
under microaerobic condition, suggesting the involvement of FNR or FNR-like
proteins in modulating its activity. The possibility of a second level of
control by CRP is also indicated. Oxygen responsive nature and regulatory
characteristics of vgb promoter offers a novel system for the expression of gene
in heterologous bacterial hosts in an oxygen dependent manner.

PMID: 8037759 [PubMed - indexed for MEDLINE]

240: Genes Dev. 1994 Jul 1;8(13):1600-12. 

The cellular concentration of the sigma S subunit of RNA polymerase in
Escherichia coli is controlled at the levels of transcription, translation, and
protein stability.

Lange R, Hengge-Aronis R.

Department of Biology, University of Konstanz, Germany.

The second vegetative sigma factor sigma S (encoded by the rpoS gene) is the
master regulator in a complex regulatory network that governs the expression of
many stationary phase-induced and osmotically regulated genes in Escherichia
coli. Using a combination of gene-fusion technology and quantitative immunoblot,
pulse-labeling, and immunoprecipitation analyses, we demonstrate here that
rpoS/sigma S expression is not only transcriptionally controlled, but is also
extensively regulated at the levels of translation and protein stability. rpoS
transcription is inversely correlated with growth rate and is negatively
controlled by cAMP-CRP. In complex medium rpoS transcription is stimulated
during entry into stationary phase, whereas in minimal media, it is not
significantly induced. rpoS translation is stimulated during transition into
stationary phase as well as by an increase in medium osmolarity. A model
involving mRNA secondary structure is suggested for this novel type of
post-transcriptional growth phase-dependent and osmotic regulation. Furthermore,
sigma S is a highly unstable protein in exponentially growing cells (with a
half-life of 1.4 min), that is stabilized at the onset of starvation. When cells
are grown in minimal glucose medium, translational induction and sigma S
stabilization occur in a temporal order with the former being stimulated already
in late exponential phase and the latter taking place at the onset of
starvation. Although sigma S does not control its own transcription, it is
apparently indirectly involved in a negative feedback control that operates on
the post-transcriptional level. Our analysis also indicates that at least five
different signals [cAMP, a growth rate-related signal (ppGpp?), a cell density
signal, an osmotic signal, and a starvation signal] are involved in the control
of all these processes that regulate rpoS/sigma S expression.

PMID: 7525405 [PubMed - indexed for MEDLINE]

241: EMBO J. 1994 Jul 1;13(13):3077-82. 

Mechanism of the down-regulation of cAMP receptor protein by glucose in
Escherichia coli: role of autoregulation of the crp gene.

Ishizuka H, Hanamura A, Inada T, Aiba H.

Department of Molecular Biology, School of Science, Nagoya University, Japan.

Glucose causes catabolite repression by lowering the intracellular levels of
both cAMP and cAMP receptor protein (CRP) in Escherichia coli. The molecular
mechanism underlying the down-regulation of CRP by glucose has been
investigated. We show that glucose lowers the level of crp mRNA without
affecting its stability. Replacement of the crp promoter with the bla promoter
almost completely abolishes the glucose-mediated regulation of crp expression.
Only a slight reduction in the crp expression by glucose is observed in cya- or
crp- strains, suggesting that a CRP-cAMP complex is needed for this regulation.
We previously showed that transcription of the crp gene is regulated both
negatively and positively. Positive autoregulation of crp is caused by the
binding of CRP-cAMP to the CRP binding site II located upstream of the crp
promoter. Here we show that disrupting the CRP binding site II essentially
eliminates the down-regulation of crp expression by glucose. We conclude that
the autoregulatory circuit of the crp gene plays a key role in the
down-regulation of CRP by glucose.

PMID: 7518773 [PubMed - indexed for MEDLINE]

242: J Biol Chem. 1994 Jun 24;269(25):17221-7. 

Slippage synthesis at the galP2 promoter of Escherichia coli and its regulation
by UTP concentration and cAMP.cAMP receptor protein.

Jin DJ.

Laboratory of Molecular Biology, National Cancer Institute, National Institutes
of Health, Bethesda, Maryland 20892.

An intriguing mechanism in regulating transcription initiation from the gal
operon in Escherichia coli is described. Initiation from galP2, one of the two
promoters of the E. coli galactose operon, is shown to be subject to promoter
clearance control in responding to changes in UTP concentration. In vitro, RNA
polymerase (RNAP) makes a large amount of nonproductive "stuttering" initiation
products at the galP2 promoter at high concentrations of UTP and less of the
stuttered products at low concentrations of UTP. Conversely, RNAP makes more
productive initiation products at low UTP concentration than at high UTP
concentration. The transcription factor cAMP.CRP complex which normally inhibits
transcription from galP2 also represses the stuttering synthesis from galP2.
When galactose is used as a sole carbon source and the internal UTP pools are
adjusted externally, a cya mutant (in which galP2 is mainly responsible for the
expression of the gal operon and galP1 activity is minimal) has a slower growth
rate and lower expression of the gal operon at high UTP pools than at low UTP
pools. Such an apparent correlation between the in vitro and in vivo results
allows one to speculate that changes in UTP concentration can modulate the
expression of the gal operon. The implication of a gal promoter being controlled
by UTP is discussed.

PMID: 7516334 [PubMed - indexed for MEDLINE]

243: J Bacteriol. 1994 May;176(10):2914-21. 

A peroxide/ascorbate-inducible catalase from Haemophilus influenzae is
homologous to the Escherichia coli katE gene product.

Bishai WR, Smith HO, Barcak GJ.

Department of Medicine, Johns Hopkins Hospital, Baltimore, Maryland.

Bacterial catalases are induced by exposure to peroxide (e.g., Escherichia coli
katG) or entry into stationary phase (e.g., E. coli katE). To study regulatory
systems in Haemophilus influenzae, we complemented an E. coli rpoS mutant, which
is unable to induce katE in stationary phase, with a plasmid library of H.
influenzae Rd- chromosomal DNA. Nineteen complementing clones with a
catalase-positive phenotype were obtained and characterized after screening
about 10(5) transformants. All carried the same structural gene for an H.
influenzae catalase. The DNA sequence of this gene, called hktE, encodes a
508-amino-acid polypeptide with strong homology to eukaryotic catalases and E.
coli katE. However, hktE is regulated like E. coli katG, with catalase activity
increasing 10-fold and hktE mRNA levels increasing 4-fold upon exposure to
ascorbic acid, which serves to generate hydrogen peroxide. Mutations in the
known global regulatory genes of H. influenzae--crp, cya, and sxy--do not affect
the inducibility of hktE. The hktE gene maps to a 225-kb segment of the H.
influenzae chromosome in a region encoding resistance to spectinomycin.

PMID: 8188593 [PubMed - indexed for MEDLINE]

244: Mol Microbiol. 1994 Apr;12(2):231-40. 

Modulated expression of promoters containing upstream curved DNA sequences by
the Escherichia coli nucleoid protein H-NS.

Zuber F, Kotlarz D, Rimsky S, Buc H.

Unite de Physicochimie des Macromolecules Biologiques (URA 1149 du CNRS),
Institut Pasteur, Paris, France.

Replacement of the CRP-binding site of the gal control region by curved
sequences can lead to the restoration of promoter strength in vivo. One curved
sequence called 5A6A, however, failed to do so. The gene hns exerts a strong
negative control on the resulting 5A6A gal promoter as well as on the distant
bla promoter, specifically in a 5A6A gal context. The product of this gene,
H-NS, displays a better affinity for this particular insert compared to other
curved sequences. Mechanisms by which H-NS may repress promoters both at short
and long distances from a favoured binding site are discussed.

PMID: 8057848 [PubMed - indexed for MEDLINE]

245: Mol Microbiol. 1994 Apr;12(1):95-104. 

The pdhR-aceEF-lpd operon of Escherichia coli expresses the pyruvate
dehydrogenase complex.

Quail MA, Haydon DJ, Guest JR.

Krebs Institute, Department of Molecular Biology and Biotechnology, University
of Sheffield, UK.

Transcript mapping and studies with lacZ translational fusions have shown that
the pdhR gene (formerly genA) is the proximal gene of the pdhR-aceE-aceF-lpd
operon encoding the pyruvate dehydrogenase (PDH) complex of Escherichia coli. A
pdhR-lpd read-through transcript (7.4 kb) initiating at the pyruvate-inducible
pdh promoter, and a smaller lpd transcript (1.7 kb) initiating at the
independent lpd promoter, were identified. Evidence showing that the pdhR gene
product negatively regulates the synthesis of the PdhR protein and the PDH
complex via the pdh promoter was obtained, with pyruvate (or a derivative)
serving as the putative inducing coeffector. The partially purified PdhR protein
was also found to specifically retard and protect DNA fragments containing the
pdh promoter region. The pdh promoter was not strongly controlled by ArcA, FNR
or CRP.

PMID: 8057842 [PubMed - indexed for MEDLINE]

246: Mol Microbiol. 1994 Apr;12(1):83-93. 

Expression of the nmpC gene of Escherichia coli K-12 is modulated by external
pH. Identification of cis-acting regulatory sequences involved in this
regulation.

Coll JL, Heyde M, Portalier R.

Laboratoire de Microbiologie et Genetique Moleculaire (UMR CNRS 106), Universite
Claude Bernard Lyon, Villeubanne, France.

Using a set of gene fusions generated with TnphoA, we previously identified the
phmA locus, whose expression is modulated as a function of external pH (pHo).
The phmA::phoA fusion was cloned and sequenced and the phmA locus was identified
with the nmpC gene. This gene lies within the defective lambdoid prophage qsr'
and NmpC is an outer membrane protein which functions as a porin. We
demonstrated that nmpC is sensitive to catabolite repression and dependent on
the CRP-cAMP complex. However, cAMP is not a signal for the pHo-dependent
expression of nmpC. By generating step deletions in the sequence 5' to the nmpC
coding region, we identified a DNA region in position -345 to -127 which is
involved in nmpC repression, mainly during growth at acid pHo. Four regions with
strong homologies and a very well-conserved organization of the functional
sequence were found in the nmpC and ompF promoters. We propose that the negative
regulation of nmpC during growth at low pHo might involve DNA looping of the
nmpC promoter.

PMID: 8057841 [PubMed - indexed for MEDLINE]

247: J Biol Chem. 1994 Feb 18;269(7):4767-72. 

Promoter switch in the Escherichia coli pts operon.

Ryu S, Garges S.

Laboratory of Molecular Biology, National Cancer Institute, National Institutes
of Health, Bethesda, Maryland 20892.

The ptsH operon of Escherichia coli is controlled by two promoters P0 and P1,
each of which is regulated by cyclic AMP receptor protein (CRP) complexed with
cAMP (CRP.cAMP). We have studied the in vitro as well as in vivo transcriptional
regulation of these two promoters. Each promoter exhibits a switching mechanism
in vitro, where, depending upon the presence or absence of CRP.cAMP,
transcription is initiated from different start sites termed a and b. P0 (P0a)
is affected by supercoiling: when the template is linear, transcription
initiation is switched to a site 3 base pairs upstream (P0b) and becomes more
CRP.cAMP dependent. Transcription from the P1 promoter (P1a) switches initiation
sites to 7 base pairs downstream (P1b) in the presence of CRP.cAMP. Most
transcription in vivo was from P1a, and P0b could not be detected in vivo.
Glucose has independent positive effects on pts expression in vivo. The results
indicate that the two different regulatory mechanisms (one through CRP.cAMP, the
other through glucose) are working together for fine control of pts expression.

PMID: 8106445 [PubMed - indexed for MEDLINE]

248: J Bacteriol. 1993 Dec;175(24):7910-7. 

Complex transcriptional control of the sigma s-dependent
stationary-phase-induced and osmotically regulated osmY (csi-5) gene suggests
novel roles for Lrp, cyclic AMP (cAMP) receptor protein-cAMP complex, and
integration host factor in the stationary-phase response of Escherichia coli.

Lange R, Barth M, Hengge-Aronis R.

Department of Biology, University of Konstanz, Germany.

osmY (csi-5) is a representative of a large group of sigma s-dependent genes in
Escherichia coli that exhibit both stationary-phase induction and osmotic
regulation. A chromosomal transcriptional lacZ fusion (csi-5::lacZ) was used to
study the regulation of osmY. We show here that in addition to sigma s, the
global regulators Lrp, cyclic AMP (cAMP) receptor protein-cAMP complex
(cAMP-CRP), and integration host factor (IHF) are involved in the control of
osmY. All three regulators negatively modulate the expression of osmY, and they
act independently from sigma s. Stationary-phase induction of osmY in minimal
medium can be explained by stimulation by sigma s combined with a relief of Lrp
repression. Stationary-phase induction of osmY in rich medium is mediated by the
combined action of sigma s, Lrp, cAMP-CRP, and IHF, with the latter three
proteins acting as transition state regulators. The transcriptional start site
of osmY was determined and revealed an mRNA with an unusual long nontranslated
leader of 244 nucleotides. The regulatory region is characterized by a sigma
70-like -10 promoter region and contains potential binding sites for Lrp, CRP,
and IHF. Whereas sigma s, Lrp, CRP, and IHF are clearly involved in
stationary-phase induction, none of these regulators is essential for osmotic
regulation of osmY.

PMID: 8253679 [PubMed - indexed for MEDLINE]

249: J Mol Biol. 1993 Nov 5;234(1):87-98. 

A regulatory cascade in the induction of rhaBAD.

Egan SM, Schleif RF.

Biology Department, Johns Hopkins University, Baltimore, MD 21218.

The RhaS and RhaR regulatory proteins are encoded in the Escherichia coli
L-rhamnose gene cluster. We used complementation analysis and DNA mobility shift
assays to show that RhaR is not the direct activator of the L-rhamnose catabolic
operon, rhaBAD. An in-frame deletion of rhaS (rhaS-rhaR+) eliminated expression
from the rhaBAD promoter, pBAD, while overexpression of rhaS greatly speeded the
normally slow induction of transcription from pBAD. Expression from pBAD in a
coupled transcription-translation assay was only detected when rhaS+ DNA was
added to allow synthesis of RhaS protein. RhaS thus appears to be the direct
L-rhamnose-specific activator of rhaBAD expression. Deletion mapping located the
binding site for the L-rhamnose-specific regulator to a region overlapping
position -70 relative to the rhaBAD transcription start site. Deletion mapping
and DNA mobility shift assays located a CRP binding site just upstream from the
binding site for the L-rhamnose-specific regulator. Quantitative primer
extension analysis showed that induction of both the rhaBAD and rhaSR messages
was unusually slow, requiring 40 to 50 minutes to reach a steady-state level.
Induction of rhaBAD apparently involves a regulatory cascade in which RhaR first
induces rhaSR expression, then RhaS accumulates and induces rhaBAD expression.

PMID: 8230210 [PubMed - indexed for MEDLINE]

250: Cell. 1993 Nov 5;75(3):557-66. 

Protein-protein interactions in gene regulation: the cAMP-CRP complex sets the
specificity of a second DNA-binding protein, the CytR repressor.

Sogaard-Andersen L, Valentin-Hansen P.

Department of Molecular Biology, Odense University, Denmark.

Maximal repression by the CytR protein depends on the formation of nucleoprotein
complexes in which CytR interacts with DNA and with cAMP-cAMP receptor protein
(CRP). Here we demonstrate that CytR regulates transcription from deoP2
promoters in which the entire CytR recognition sequence has been eliminated.
Furthermore, CytR proteins deleted for the DNA-binding domain repress deoP2 in
vivo and interact with deoP2 in vitro in a strictly cAMP-CRP-dependent fashion.
These experiments show that the site of action of CytR can be specified by
protein-protein interactions to cAMP-CRP, whereas CytR-DNA interactions may
primarily serve to stabilize the nucleo-protein complex. This type of
specificity mechanism may represent a general concept in the recruitment of
DNA-binding proteins in combinatorial regulatory systems.

PMID: 8221894 [PubMed - indexed for MEDLINE]

251: J Bacteriol. 1993 Nov;175(22):7142-9. 

The Haemophilus influenzae adenylate cyclase gene: cloning, sequence, and
essential role in competence.

Dorocicz IR, Williams PM, Redfield RJ.

Department of Biochemistry, University of British Columbia, Vancouver, Canada.

Competence for transformation in Haemophilus influenzae is stimulated by cyclic
AMP (cAMP) and requires the cAMP-dependent catabolite regulatory protein CRP.
Thus, understanding the control of competence will require understanding how
cAMP levels are regulated. As a first step, we have cloned the H. influenzae
adenylate cyclase gene (cya) by complementing the Lac- phenotype of delta cya
Escherichia coli. Its sequence specifies an 843-amino-acid protein which has
significant identity to other known bacterial adenylate cyclases (41 to 43% and
61% identical to the cya genes of enteric bacteria and of Pasteurella multocida,
respectively). As seen in other bacterial cya genes, there is evidence for
regulation similar to that demonstrated for E. coli: the presence of a strong
consensus CRP binding site within the promoter of the gene may provide feedback
control of cAMP levels by repressing cya transcription, and translation may be
limited by the weak ribosome binding site and by initiation of protein synthesis
with GUG rather than AUG or the UUG used in other bacterial cya genes. We
confirmed the essential role of cAMP in competence by constructing and
characterizing H. influenzae cya mutants. This strain failed to develop
competence either spontaneously or after transfer to a competence-inducing
medium. However, it became as competent as its wild-type parent in the presence
of exogenous cAMP. This result suggests that the failure of exogenously added
cAMP to induce optimum competence in wild-type cells is not due to a limitation
to the entry of cAMP into the cells. Rather, it strongly favors models in which
competence induction requires both an increase in intracellular cAMP and a
second as yet unidentified regulatory event. H. influenzae strains mutant in cya
or crp were unable to ferment xylose or ribose. This confirms that influenzae,
like E. coli, uses cAMP and CRP to regulate nutrient uptake and utilization and
lends increasing support to the hypothesis that DNA uptake is mechanism of
nutrient acquisition.

PMID: 8226661 [PubMed - indexed for MEDLINE]

252: Mol Microbiol. 1993 Oct;10(2):407-20. 

Identification and characterization of stationary phase-inducible genes in
Escherichia coli.

Weichart D, Lange R, Henneberg N, Hengge-Aronis R.

Department of Biology, University of Konstanz, Germany.

During transition into stationary phase a large set of proteins is induced in
Escherichia coli. Only a minority of the corresponding genes has been identified
so far. Using the lambda placMu system and a plate screen for carbon
starvation-induced fusion activity, a series of chromosomal lacZ fusions
(csi::lacZ) was isolated. In complex medium these fusions were induced either
during late exponential phase or during entry into stationary phase. csi::lacZ
expression in minimal media in response to starvation for carbon, nitrogen and
phosphate sources and the roles of global regulators such as the alternative
sigma factor sigma s (encoded by rpoS), cAMP/CRP and the relA gene product were
investigated. The results show that almost every fusion exhibits its own
characteristic pattern of expression, suggesting a complex control of stationary
phase-inducible genes that involves various combinations of regulatory
mechanisms for different genes. All fusions were mapped to the E. coli
chromosome. Using fine mapping by Southern hybridization, cloning, sequencing
and/or phenotypic analysis, csi-5, csi-17, and csi-18 could be localized in osmY
(encoding a periplasmic protein), glpD (aerobic glycerol-3-phosphate
dehydrogenase) and glgA (glycogen synthase), respectively. The other fusions
seem to specify novel genes now designated csiA through to csiF.
csi-17(glpD)::lacZ was shown to produce its own glucose-starvation induction,
thus illustrating the intricacies of gene-fusion technology when applied to the
study of gene regulation.

PMID: 7934831 [PubMed - indexed for MEDLINE]

253: Mol Microbiol. 1993 Oct;10(2):245-51. 

The galactose regulon of Escherichia coli.

Weickert MJ, Adhya S.

Somatogen Inc., Boulder, Colorado 80301.

Galactose transport and metabolism in Escherichia coli involves a multicomponent
amphibolic pathway. Galactose transport is accomplished by two different
galactose-specific transport systems. At least four of the genes and operons
involved in galactose transport and metabolism have promoters containing similar
regulatory sequences. These sequences are recognized by at least three
regulators, Gal repressor (GalR), Gal isorepressor (GalS) and cAMP receptor
protein (CRP), which modulate transcription from these promoters. The negative
regulators, GalR and GalS, discriminate between utilization of the high-affinity
(regulated by GalS) and low-affinity (regulated by GalR) transport systems, and
modulate the expression of genes for galactose metabolism in an overlapping
fashion. GalS is itself autogenously regulated and CRP dependent, while the gene
for GalR is constitutive. The gal operon encoding the enzymes for galactose
metabolism has two promoters regulated by CRP in opposite ways; one (P1) is
stimulated and the other (P2) inhibited by CRP. Both promoters are strongly
repressed by GalR but weakly by GalS. All but one of the constituent promoters
of the gal regulon have two operators. The gal regulon has the potential to
coordinate galactose metabolism and transport in a highly efficient manner,
under a wide variety of conditions of galactose availability.

Publication Types:
    Review

PMID: 7934815 [PubMed - indexed for MEDLINE]

254: Mol Microbiol. 1993 Sep;9(6):1255-65. 

Regulation and sequence of the structural gene for cytochrome c552 from
Escherichia coli: not a hexahaem but a 50 kDa tetrahaem nitrite reductase.

Darwin A, Hussain H, Griffiths L, Grove J, Sambongi Y, Busby S, Cole J.

School of Biochemistry, University of Birmingham, UK.

The structural gene, nrfA, for cytochrome c552, which is the terminal reductase
of the formate-dependent pathway for nitrite reduction to ammonia, has been
located at co-ordinate 4366 on the physical map of the Escherichia coli
chromosome. The DNA sequence of nrfA encodes a tetrahaem c-type cytochrome with
a predicted M(r) for the unprocessed product of 53,788. Cleavage of the putative
signal peptide at Ala-26 would result in a mature, periplasmic cytochrome of
M(r) 50,580 rather than a larger hexahaem cytochrome, as has been widely
reported previously. A cytochrome of this size was detected by staining
SDS-polyacrylamide gels for covalently bound haem. This cytochrome was partially
purified by anion exchange chromatography and confirmed to be cytochrome c552 by
difference spectroscopy. Similar cytochromes were detected in five other E. coli
strains including strain ST 249, which was used previously to purify and
characterize the protein. A plasmid with an in-phase deletion within nrfA
directed the synthesis of a truncated haemoprotein of the predicted mass.
In-phase translational fusions to lacZ were used to locate the nrfA translation
start, and the transcription start site was found by S1 mapping. Expression from
the FNR-dependent nrfA promoter was almost totally repressed during aerobic
growth, partially induced during anaerobic growth in the absence of nitrite or
in the presence of nitrate, but fully induced only during anaerobic growth in
the presence of nitrite. No nitrate repression was detected in a narL mutant,
but nitrite induction was unaffected, indicating that the nitrite-sensing
mechanism is independent of the NarL protein. Expression from the nrfA promoter
was subject to glucose repression but regulation was independent of the CRP-cAMP
complex.

PMID: 7934939 [PubMed - indexed for MEDLINE]

255: Biochemistry. 1993 Aug 17;32(32):8130-9. 

Energetics of intersubunit and intrasubunit interactions of Escherichia coli
adenosine cyclic 3',5'-phosphate receptor protein.

Cheng X, Gonzalez ML, Lee JC.

Department of Human Biological Chemistry and Genetics, University of Texas
Medical Branch, Galveston 77550.

Escherichia coli cAMP receptor protein (CRP) regulates the expression of a large
number of catabolite-sensitive genes. The mechanism of CRP regulation most
likely involves communication between subunits and domains. A specific message,
such as the activation of CRP, may be manifested as a change in the interactions
between these structural entities. Hence, the elucidation of the regulatory
mechanism would require a quantitative evaluation of the energetics involved in
these interactions. Thus, a study was initiated to define the conditions for
reversible denaturation of CRP and to quantitatively assess the energetics
involved in the intra- and intersubunit interactions in CRP. The denaturation of
CRP was induced by guanidine hydrochloride. The equilibrium unfolding reaction
of CRP was monitored by three spectroscopic techniques, namely, fluorescence
intensity, fluorescence anisotropy, and circular dichroism. The spectroscopic
data implied that CRP unfolds in a single cooperative transition. Sedimentation
equilibrium data showed that CRP is dissociated into its monomeric state in high
concentrations of denaturant. Unfolding of CRP is completely reversible, as
indicated by fluorescence and circular dichroism measurements, and sedimentation
data indicated that a dimeric structure of CRP was recovered. The functional and
other structural properties of renatured and native CRP have also been examined.
Quantitatively identical results were obtained. Results from additional studies
as a function of protein concentration and from computer simulation demonstrated
that the denaturation of CRP induced by guanidine hydrochloride proceeds
according to the following pathway:
(CRP2)Native<-->2(CRP)Native<-->2(CRP)Denatured. The delta G values for
dissociation (delta Gd) and unfolding (delta G(u)) in the absence of guanidine
hydrochloride were determined by linear extrapolation, yielding values of 12.0
+/- 0.6 and 7.2 +/- 0.1 kcal/mol, respectively. To examine the effect of the DNA
binding domain on the stability of the cAMP binding domain, two proteolytically
resistant cAMP binding cores were prepared from CRP in the presence of cAMP by
subtilisin and chymotrypsin digestion, yielding S-CRP and CH-CRP, respectively.
Results from an equilibrium denaturation study indicated that the denaturation
of both CH-CRP and S-CRP is also completely reversible. Both S-CRP and CH-CRP
exist as stable dimers with similar delta Gd values of 10.1 +/- 0.4 and 9.5 +/-
0.4 kcal/mol, respectively. Results from this study in conjunction with
crystallographic data [McKay, D. B., Weber, I. T., & Stietz, T. A. (1982) J.
Biol. Chem. 257, 9518-9524] indicate that the DNA binding domain and the C-helix
are not the only structural elements that are responsible for subunit
dimerization.(ABSTRACT TRUNCATED AT 400 WORDS)

PMID: 8394127 [PubMed - indexed for MEDLINE]

256: Mol Microbiol. 1993 Jul;9(1):165-72. 

Regulation of the ansB gene of Salmonella enterica.

Jennings MP, Scott SP, Beacham IR.

Division of Science and Technology, Griffith University, Nathan, Queensland,
Australia.

The expression of L-asparaginase II (encoded by ansB) in Salmonella enterica was
found to be positively regulated by the cAMP receptor protein (CRP) and
anaerobiosis. The anaerobic regulation of the S. enterica ansB gene is not
mediated by the anaerobic transcriptional activator FNR. This is unlike the
situation of the ansB gene of Escherichia coli, which is dependent on both CRP
and FNR. To investigate this fundamental difference in the regulation of
L-asparaginase II expression in S. enterica, the ansB gene was cloned and the
nucleotide sequence of the promoter region determined. Sequence analysis and
transcript mapping of the 5' promoter region revealed a single transcriptional
start point (tsp) and two regulatory sites with substantial homology with those
found in E. coli. One site, centred -90.5 bp from the tsp, is homologous to a
hybrid CRP/FNR ('CF') site which is the site of CRP regulation in the E. coli
promoter. The other site, centred 40.5 bp upstream of the tsp, is homologous to
the FNR binding site of the E. coli promoter. Significantly, however, a single
base-pair difference exists in this site, at a position of the related CRP and
FNR DNA-binding site consensus sequences known to be involved in CRP versus FNR
specificity. Site-directed mutagenesis indicates that this single difference,
relative to the homologous E. coli site, results in a CRP binding site and the
observed FNR-independent ansB expression in S. enterica.(ABSTRACT TRUNCATED AT
250 WORDS)

PMID: 8412661 [PubMed - indexed for MEDLINE]

257: Mol Microbiol. 1993 Jul;9(1):155-64. 

Co-dependent positive regulation of the ansB promoter of Escherichia coli by CRP
and the FNR protein: a molecular analysis.

Jennings MP, Beacham IR.

Division of Science and Technology, Griffith University, Nathan, Queensland,
Australia.

Transcription of the ansB gene, encoding L-asparaginase II, is positively
regulated by cAMP receptor protein (CRP) and by the product of the fnr gene, the
FNR protein. These global regulatory proteins mediate the expression of ansB in
Escherichia coli in response to carbon source and to anaerobiosis, respectively,
and are required concurrently for optimal ansB expression. The mechanism whereby
CRP and FNR interact co-operatively with the ansB promoter to achieve
transcription has not previously been established. We have utilized an
ansB'-'lacZ fusion, in conjunction with deletion analysis and site-directed
mutagenesis, to identify two sites which interact with these regulatory proteins
in the ansB promoter. The first is an FNR site, centred 41.5 bp upstream of the
major transcriptional start site. The second site, located 28 bp upstream of the
FNR site, is the site of CRP regulation. This site is homologous to both the CRP
and FNR binding-site consensus sequences and may respond to both CRP and FNR.
The concurrent requirement for CRP and FNR for optimal expression of ansB may be
explained if, first, essentially no transcription occurs unless the FNR is bound
at the downstream site, and, second, the level of transcription when FNR alone
is present is enhanced when CRP binds at the upstream site.

PMID: 8412660 [PubMed - indexed for MEDLINE]

258: J Bacteriol. 1993 Jul;175(13):4025-35. 

Anabaena sp. strain PCC 7120 bifA gene encoding a sequence-specific DNA-binding
protein cloned by in vivo transcriptional interference selection.

Wei TF, Ramasubramanian TS, Pu F, Golden JW.

Department of Biology, Texas A&M University, College Station 77843-3258.

VF1 is a DNA-binding protein from the cyanobacterium Anabaena sp. strain PCC
7120. VF1 was originally identified on the basis of its binding affinity to the
upstream region of xisA, which encodes a heterocyst-specific site-specific
recombinase. VF1 also binds to the glnA, rbcL, and nifH promoters in vitro,
suggesting that VF1 interacts with genes expressed in both vegetative cells and
heterocysts. The role of VF1 in regulating gene expression in PCC 7120 is
unknown. As a step towards the goal of understanding the role of VF1 in
regulating gene expression, we have cloned the bifA gene by using a genetic
selection strategy. bifA encodes a protein, BifA, that has chromatographic and
DNA-binding properties indistinguishable from those of VF1. The cloning strategy
was based on a transcriptional interference assay in which a strong synthetic
promoter, conII, interferes with the expression of an aadA gene, which provides
resistance to spectinomycin and streptomycin (S. J. Elledge, P. Sugiono, L.
Guarente, and R. W. Davis, Proc. Natl. Acad. Sci. USA 86:3689-3693, 1989). A
selection plasmid, pAM994, which has the conII promoter negatively regulated by
a VF1-binding site, was used to enrich for VF1-producing clones from an
expression library containing PCC 7120 DNA fragments. Mobility shift assays were
used to identify a 672-bp open reading frame that encoded VF1-like binding
activity. The deduced BifA amino acid sequence shows 77% identity to NtcA, which
is a global regulator involved in nitrogen control in Synechococcus sp. strain
PCC 7942. Both BifA and NtcA belong to the cyclic AMP receptor protein (CRP)
family of prokaryotic regulatory proteins. Genes similar to envM, hisB, and
ORF60-5 were found near the bifA gene.

PMID: 8391534 [PubMed - indexed for MEDLINE]

259: J Bacteriol. 1993 Apr;175(7):2026-36. 

Global regulation of gene expression in Escherichia coli.

Chuang SE, Daniels DL, Blattner FR.

Laboratory of Genetics, University of Wisconsin-Madison 53706.

Global transcription responses of Escherichia coli to various stimuli or genetic
defects were studied by measuring mRNA levels in about 400 segments of the
genome. Measuring mRNA levels was done by analyzing hybridization to DNA dot
blots made with overlapping lambda clones spanning the genome of E. coli K-12.
Conditions examined included isopropyl-beta-D-thiogalactopyranoside (IPTG)
induction, heat shock, osmotic shock, starvation for various nutrients, entrance
of cells into the stationary phase of growth, anaerobic growth in a tube, growth
in the gnotobiotic mouse gut, and effects of pleiotropic mutations rpoH, himA,
topA, and crp. Most mapped genes known to be regulated by a particular situation
were successfully detected. In addition, many chromosomal regions containing no
previously known regulated genes were discovered that responded to various
stimuli. This new method for studying globally regulated genetic systems in E.
coli combines detection, cloning, and physical mapping of a battery of
coregulated genes in one step.

PMID: 8458845 [PubMed - indexed for MEDLINE]

260: Mol Microbiol. 1993 Apr;8(2):253-9. 

The Escherichia coli cAMP receptor protein (CRP) represses the Rhizobium
meliloti dctA promoter in a cAMP-dependent fashion.

Wang YP, Giblin L, Boesten B, O'Gara F.

Microbiology Department, University College, Cork, Ireland.

The expression of the Rhizobium meliloti C4-dicarboxylic acid permease gene
(dctA) is controlled by the sensor DctB and the transcriptional regulator, DctD.
The R. meliloti Dct system has been reconstituted in Escherichia coli.
Expression of the dctA promoter is DctBD dependent and is induced in the
presence of C4-dicarboxylic acids (dCA). Other carbon sources also influence
dctA expression. We demonstrate that the cAMP receptor protein (CRP) has a
repressive effect on the dctA promoter. A mutated CRP molecule (CRP-H159L),
unable to activate catabolic promoters (but still proficient in DNA binding),
gives similar results. This suggests that the CRP-cAMP complex represses the
dctA promoter activity by direct interaction with the DNA. Direct binding of the
CRP-cAMP complex to the dctA promoter was confirmed in vitro by gel
mobility-shift assays. Sequence analysis of the dctA promoter indicates that the
most likely binding sites for CRP are the two confirmed DctD-binding sites. It
is proposed that the CRP-cAMP complex competes with DctD for occupancy of these
sites. Since in the presence of CRP-cAMP complex the uninduced levels of dctA
expression are reduced, whereas induced levels are largely unaffected, such
competition appears to be an essential regulatory feature of dctA expression.

PMID: 8391103 [PubMed - indexed for MEDLINE]

261: Proc Natl Acad Sci U S A. 1993 Apr 1;90(7):3083-7. 

Synergistic activation of transcription by Escherichia coli cAMP receptor
protein.

Joung JK, Le LU, Hochschild A.

Department of Microbiology and Molecular Genetics, Harvard Medical School,
Boston, MA 02115.

Activation of gene expression in eukaryotes generally involves the action of
multiple transcription factors that function synergistically when bound near a
particular target gene. Such effects have been suggested to occur because
multiple activators can interact simultaneously with one or more components of
the basal transcription machinery. In prokaryotes, examples of synergistic
effects on transcription are much more limited and can often be explained by
cooperative DNA binding. Here we show that the Escherichia coli cAMP receptor
protein (CRP) functions synergistically to activate transcription from a
derivative of the lac promoter that bears a second CRP-binding site upstream of
the natural binding site. We present evidence indicating that cooperative DNA
binding of two CRP dimers does not account for the magnitude of the observed
cooperative activation. We suggest, instead, that the two dimers stimulate
transcription directly by contacting two distinct surfaces of RNA polymerase
simultaneously. Thus, synergistic activation by CRP may provide a relatively
simple model for examining the molecular basis of such effects in higher
organisms.

PMID: 7681995 [PubMed - indexed for MEDLINE]

262: Biochemistry. 1993 Mar 2;32(8):2104-10. 

Radiolytic footprinting. Beta rays, gamma photons, and fast neutrons probe
DNA-protein interactions.

Franchet-Beuzit J, Spotheim-Maurizot M, Sabattier R, Blazy-Baudras B, Charlier
M.

Centre de Biophysique Moleculaire, CNRS, Orleans, France.

Ionizing radiations induce numerous damages in DNA, especially strand breaks.
The hydroxyl radical OH., produced by the radiolysis of water, is mainly
responsible for this effect. The fact that strand breakage occurs at all
nucleotides and that bound proteins may locally radioprotect DNA at the binding
site lead us to develop a radiolytic footprinting method to study DNA-protein
interactions. Three different radiations were used: beta rays, gamma photons,
and fast neutrons. In order to validate this technique, three well-known
interaction systems were tested: the lac repressor-lac operator of Escherichia
coli, the cyclic AMP receptor protein (CRP) of E. coli and its specific site in
the lac regulation region, and the core nucleosome. Radiolytic footprinting
gives results similar to those obtained by more classical probes: DNase I,
complexes of orthophenanthroline (OP) and copper, complexes of
ethylenediaminetetraacetate ion (EDTA) and iron, and UV light. For the same
system (lac repressor), irradiation with either gamma photons or fast neutrons
gives identical results.

PMID: 8383534 [PubMed - indexed for MEDLINE]

263: Mol Microbiol. 1993 Mar;7(6):993-1006. 

Transcriptional organization of the F1845 fimbrial adhesin determinant of
Escherichia coli.

Bilge SS, Apostol JM Jr, Fullner KJ, Moseley SL.

Department of Microbiology, University of Washington, Seattle 98195.

The transcriptional organization of the gene cluster encoding the F1845 fimbrial
adhesin of a diarrhoea-associated Escherichia coli was investigated. Genes daaA
to daaE were determined to constitute a single transcriptional unit under the
control of the daaA promoter. The nucleotide sequence of daaA and that of an
upstream open reading frame encoded on the opposite strand, designated daaF,
were determined to share limited homology with the papB and papI genes of the P
fimbrial adhesin, respectively. The 5' termini of the daaF and daaABCDE
transcripts were mapped by primer extension and nuclease protection analyses.
The promoters for these transcripts were associated with potential regulatory
sequences including two consensus leucine-responsive regulatory protein
(Lrp)-binding sites which contained differentially methylated GATC sequences, a
cAMP-CRP-binding site, and an integration host factor (IHF)-binding site.
Expression of the daa locus was determined to be dependent on Lrp, subject to
catabolite repression, and dependent on IHF.

PMID: 8097864 [PubMed - indexed for MEDLINE]

264: Nucleic Acids Res. 1993 Feb 25;21(4):879-85. 

Identification of the nucleotide sequence recognized by the cAMP-CRP dependent
CytR repressor protein in the deoP2 promoter in E. coli.

Rasmussen PB, Sogaard-Andersen L, Valentin-Hansen P.

Department of Molecular Biology, Odense University, Denmark.

In E. coli repression of transcription initiation by the CytR protein relies on
CytR-DNA interactions as well as on interactions between CytR and the cAMP-CRP
activator complex. To identify the nucleotide sequence recognized by CytR,
mutants of the deoP2 promoter with a reduced regulatory response to CytR have
been isolated. Five single bp mutation derivatives of deoP2 with a 2-5-fold
decrease in CytR regulation have been characterized. In vitro, the only effect
of the mutations was a decrease in the binding affinity of CytR, and a clear
correlation was observed between the reduction in CytR regulation in vivo and
the reduction in CytR binding in vitro. The mutations all reside in a sequence
element that contains an imperfect direct as well as an imperfect inverted
repeat. As the active form of CytR, most likely, is an oligomer with two-fold
rotational symmetry, CytR probably interacts with the inverted repeat.
Degenerate versions of the inverted repeat are present in all CytR binding sites
characterized so far, however, the distance between the half-sites varies.

PMID: 8451188 [PubMed - indexed for MEDLINE]

265: J Bacteriol. 1993 Jan;175(1):251-8. 

Control of transcription of gal repressor and isorepressor genes in Escherichia
coli.

Weickert MJ, Adhya S.

Laboratory of Molecular Biology, National Cancer Institute, National Institutes
of Health, Bethesda, Maryland 20892.

Two regulatory proteins, Gal repressor and isorepressor, control the expression
of the gal and mgl operons in Escherichia coli. The transcription start sites
for galR and galS, the genes for the repressor and isorepressor, were determined
by primer extension of in vivo transcripts. Study of the promoter-lacZ gene
fusions introduced into the chromosome indicated that galS expression was
elevated in cells in which the normal galS gene was interrupted, but not in
cells in which the galR gene was deleted. When both genes were disrupted, galS
expression was further elevated. Expression from the galS promoter was
stimulated by the addition of D-fucose, repressed by glucose, and dependent on
cyclic AMP receptor protein (CRP). Expression of a similar gene fusion of the
galR promoter to lacZ was unregulated. Both galR and galS genes contain two
potential operator sites (OE and OI) and a CRP-binding site. The arrangement of
OE, OI, and the CRP-binding site in the galS gene is analogous to the
arrangement in the gal and mgl promoters, but the arrangement in galR is
atypical. The increased concentration of the isorepressor when inducer is
present may facilitate early shutoff of the isorepressor-regulated genes of the
gal regulon when inducer (substrate) concentration falls.

PMID: 8416900 [PubMed - indexed for MEDLINE]

266: Biochem J. 1992 Nov 1;287 ( Pt 3):937-41. 

Kinetics of activation of the P4 promoter of pBR322 by the Escherichia coli
cyclic AMP receptor protein.

Hoggett JG, Brierley I.

Department of Biology, University of York, Heslington, U.K.

The activation of transcription initiation from the P4 promoter of pBR322 by the
Escherichia coli cyclic AMP receptor protein (CRP) has been investigated using a
fluorescence abortive initiation assay. The effect of the cyclic-AMP/CRP complex
on the linear P4 promoter was to increase the initial binding (KB) of RNA
polymerase to the promoter by about a factor of 10, but the rate of
isomerization of closed to open complex (kf) was unaffected. One molecule of CRP
per promoter was required for activation, and the concentration of cyclic AMP
producing half-maximal stimulation was about 7-8 microM. Supercoiling caused a
2-3-fold increase in the rate of isomerization of the CRP-activated promoter,
but weakened the initial binding of polymerase by about one order of magnitude.
The unactivated supercoiled promoter was too weak to allow reliable assessment
of kinetic parameters against the high background rate originating from the rest
of the plasmid.

PMID: 1445251 [PubMed - indexed for MEDLINE]

267: J Bacteriol. 1992 Nov;174(21):6862-71. 

Sequence elements in the Escherichia coli araFGH promoter.

Hendrickson W, Flaherty C, Molz L.

Department of Microbiology and Immunology, College of Medicine, University of
Illinois, Chicago 60680.

The Escherichia coli araFGH operon codes for proteins involved in the
L-arabinose high-affinity transport system. Transcriptional regulation of the
operon was studied by creating point mutations and deletions in the control
region cloned into a GalK expression vector. The transcription start site was
confirmed by RNA sequencing of transcripts. The sequences essential for
polymerase function were localized by deletions and point mutations.
Surprisingly, only a weak -10 consensus sequence, and no -35 sequence is
required. Mutation of a guanosine at position -12 greatly reduced promoter
activity, which suggests important polymerase interactions with DNA between the
usual -10 and -35 positions. A double mutation toward the consensus in the -10
region was required to create a promoter capable of significant AraC-independent
transcription. These results show that the araFGH promoter structure is similar
to that of the galP1 promoter and is substantially different from that of the
araBAD promoter. The effects of 11 mutations within the DNA region thought to
bind the cyclic AMP receptor protein correlate well with the CRP consensus
binding sequence and confirm that this region is responsible for cyclic AMP
regulation. Deletion of the AraC binding site nearest the promoter, araFG1,
eliminates arabinose regulation, whereas deletion of the upstream AraC binding
site, araFG2, has only a slight effect on promoter activity.

PMID: 1400237 [PubMed - indexed for MEDLINE]

268: Proc Natl Acad Sci U S A. 1992 Oct 15;89(20):9700-4. 

Allosteric changes in the cAMP receptor protein of Escherichia coli: hinge
reorientation.

Kim J, Adhya S, Garges S.

Laboratory of Molecular Biology, National Cancer Institute, National Institutes
of Health, Bethesda, MD 20892.

The cAMP receptor protein (CRP) of Escherichia coli is a dimer of a two-domain
subunit. It requires binding of cAMP for a conformational change in order to
function as a site-specific DNA-binding protein that regulates gene activity.
The hinge region connecting the cAMP-binding domain to the DNA-binding domain is
involved in the cAMP-induced allosteric change. We studied the structural
changes in CRP that are required for gene regulation by making a large number of
single and double amino acid substitutions at four different positions in or
near the hinge. To achieve cAMP-independent transcription by CRP, amino acid
residues 138 (located within the hinge region) and 141 (located in the D
alpha-helix adjacent to the hinge) must be polar. This need for polar residues
at positions 138 and 141 suggests an interaction that causes the C and D
alpha-helices to come together. As a consequence, the F alpha-helix is released
from the D alpha-helix and can interact with DNA. At position 144 in the D
alpha-helix and within interacting distances of the F alpha-helix, replacement
of alanine by an amino acid with a larger side chain, regardless of its nature,
allows cAMP independence. This result indicates that pushing against the F
alpha-helix may be a way of making the helix available for DNA binding. We
believe that the cAMP-induced allosteric change involves similar hinge
reorientation to adjust the C and D alpha-helices, allowing outward movement of
the F alpha-helix.

PMID: 1409686 [PubMed - indexed for MEDLINE]

269: Proc Natl Acad Sci U S A. 1992 Oct 15;89(20):9880-4. 

Antirepression function in Escherichia coli for the cAMP-cAMP receptor protein
transcriptional activator.

Forsman K, Sonden B, Goransson M, Uhlin BE.

Department of Microbiology, University of Umea, Sweden.

The cAMP receptor protein (CRP) complex (cAMP-CRP) is a global regulator of gene
expression. It influences transcription from a number of promoters in
Escherichia coli, including two divergently oriented promoters in the pap
pili-adhesin gene system. To further define the role of cAMP-CRP in pap
regulation we monitored protein-DNA interactions in vitro and levels of pap
transcription in vivo in wild-type and mutant pap-containing clones. The results
showed that activation was mediated by a single cAMP-CRP-binding site centered
at nucleotide positions -215.5 and -115.5 relative to the transcriptional start
points. A target for the pap-specific regulatory protein PapB was localized
adjacent to the cAMP-CRP-binding site. The long-range effects exerted from the
protein-binding sites were consistent with the idea that cAMP-CRP caused a
change in the local DNA conformation and that a nucleoprotein complex (involving
cAMP-CRP and PapB) was formed in the region between the pap promoters. Moreover,
transcription became independent of activation of cAMP-CRP and the PapB protein
in a mutant lacking the nucleoid-associated protein H-NS. Our findings suggest
that the cAMP-CRP complex mediates its positive regulatory function by
alleviating transcriptional silencing and, as such, plays a role as
antirepressor.

PMID: 1384062 [PubMed - indexed for MEDLINE]

270: EMBO J. 1992 Oct;11(10):3635-43. 

The cAMP-CRP/CytR nucleoprotein complex in Escherichia coli: two pairs of
closely linked binding sites for the cAMP-CRP activator complex are involved in
combinatorial regulation of the cdd promoter.

Holst B, Sogaard-Andersen L, Pedersen H, Valentin-Hansen P.

Department of Molecular Biology, Odense University, Denmark.

Transcription initiation at CytR regulated promoters in Escherichia coli is
controlled by a combinatorial regulatory system in which the cAMP receptor
protein (CRP) functions as both an activator and a co-repressor. By combining
genetic studies and footprinting analyses, we demonstrate that regulated
expression of the CytR controlled cdd promoter requires three CRP-binding sites:
a high affinity site (CRP-1) and two overlapping low affinity sites (CRP-2 and
CRP-3) centred at positions -41, -91 and -93, respectively. In the absence of
CytR, cAMP-CRP interacts at one set of sites (CRP-1 and CRP-2) and both of these
binding sites are required for full promoter activation. In the presence of
CytR, however, the two regulators bind cooperatively to cddP forming a
nucleoprotein complex in which cAMP-CRP binds to CRP-1 and CRP-3 and CytR
occupies the sequence between these sites. Thus, association of the two
regulators involves a repositioning of the cAMP-CRP complex. Moreover, mutant
cdd promoters in which CRP-2 and CRP-3 have been deleted are partially regulated
by CytR, and cAMP-CRP and CytR still bind cooperatively to these promoters.
These findings provide clues to an understanding of how cAMP-CRP and CytR
interact at a structurally diverse set of promoters.

PMID: 1327747 [PubMed - indexed for MEDLINE]

271: J Mol Biol. 1992 Sep 20;227(2):396-406. 

cAMP-CRP activator complex and the CytR repressor protein bind co-operatively to
the cytRP promoter in Escherichia coli and CytR antagonizes the cAMP-CRP-induced
DNA bend.

Pedersen H, Sogaard-Andersen L, Holst B, Gerlach P, Bremer E, Valentin-Hansen P.

Department of Molecular Biology, Odense University, Denmark.

Initiation of transcription from the cytRP promoter in Escherichia coli is
activated by the cAMP-CRP complex and negatively regulated by the CytR repressor
protein. By combining gel retardation and footprinting assays, we show that
cAMP-CRP binds to a single site centered at position -64 and induces a
considerable bend in the DNA. CytR binds to a region immediately downstream
from, and partially overlapping, the CRP site, and induces a modest bend into
the DNA. In combination, cAMP-CRP and CytR bind co-operatively to cytRP forming
a nucleoprotein complex in which the proteins directly interact with each other
and bind to the same face of the DNA helix. CytR binding concomitantly
antagonizes the cAMP-CRP-induced bend. This study indicates that the minimal DNA
region required to obtain CytR regulation consists of a single binding site for
each of cAMP-CRP and CytR. The case described here, in which a protein-induced
DNA bend is modulated by a second protein, may illustrate a mechanism that
applies to other regulatory systems.

PMID: 1328649 [PubMed - indexed for MEDLINE]

272: J Bacteriol. 1992 Sep;174(18):5803-13. 

Anaerobic growth of Rhodopseudomonas palustris on 4-hydroxybenzoate is dependent
on AadR, a member of the cyclic AMP receptor protein family of transcriptional
regulators.

Dispensa M, Thomas CT, Kim MK, Perrotta JA, Gibson J, Harwood CS.

Department of Microbiology, University of Iowa, Iowa City 52242.

The purple nonsulfur phototrophic bacterium Rhodopseudomonas palustris converts
structurally diverse aromatic carboxylic acids, including lignin monomers, to
benzoate and 4-hydroxybenzoate under anaerobic conditions. These compounds are
then further degraded via aromatic ring-fission pathways. A gene termed aadR,
for anaerobic aromatic degradation regulator, was identified by complementation
of mutants unable to grow anaerobically on 4-hydroxybenzoate. The deduced amino
acid sequence of the aadR product is similar to a family of transcriptional
regulators which includes Escherichia coli Fnr and Crp, Pseudomonas aeruginosa
Anr, and rhizobial FixK and FixK-like proteins. A mutant with a deletion in aadR
failed to grow on 4-hydroxybenzoate under anaerobic conditions and grew very
slowly on benzoate. It also did not express aromatic acid-coenzyme A ligase II,
an enzyme that catalyzes the first step of 4-hydroxybenzoate degradation, and it
was defective in 4-hydroxybenzoate-induced expression of benzoate-coenzyme A
ligase. The aadR deletion mutant was unaffected in other aspects of anaerobic
growth. It grew normally on nonaromatic carbon sources and also under
nitrogen-fixing conditions. In addition, aerobic growth on 4-hydroxybenzoate was
indistinguishable from that of the wild type. These results indicate that AadR
functions as a transcriptional activator of anaerobic aromatic acid degradation.

PMID: 1522059 [PubMed - indexed for MEDLINE]

273: Mol Microbiol. 1992 Sep;6(17):2489-97. 

A new aspect of transcriptional control of the Escherichia coli crp gene:
positive autoregulation.

Hanamura A, Aiba H.

Department of Molecular Biology, School of Science, Nagoya University, Japan.

Transcription of the Escherichia coli crp gene is negatively regulated by
CRP-cAMP that binds to a specific site located downstream of the crp promoter. A
second binding site for CRP-cAMP (CRP site II) exists upstream of the crp
promoter. Using an in vitro transcription assay, we have demonstrated that
CRP-cAMP activates transcription of crp in certain conditions. A promoter which
carries an altered CRP-binding site II is no longer activated by CRP-cAMP,
indicating that CRP site II mediates the activation of crp transcription. The
concentrations of cAMP that are required for positive autoregulation are higher
than those for negative autoregulation. Evidence for positive and negative
autoregulation in vivo is presented by a quantitative S1 nuclease analysis.

PMID: 1328816 [PubMed - indexed for MEDLINE]

274: J Bacteriol. 1992 Aug;174(15):4935-42. 

Localization of upstream sequence elements required for nitrate and anaerobic
induction of fdn (formate dehydrogenase-N) operon expression in Escherichia coli
K-12.

Li J, Stewart V.

Section of Microbiology, Cornell University, Ithaca, New York 14853-8101.

Two transcriptional activators, the FNR and NARL proteins, are required for
induction of the fdnGHI operon, encoding Escherichia coli formate
dehydrogenase-N. The FNR protein is required for anaerobic expression, while the
NARL protein mediates nitrate induction. We used primer extension to locate the
transcription initiation site 29 nucleotides upstream of the fdnG translation
initiation codon. Expression assays with single-copy phi (fdnG-lacZ) gene
fusions containing various deletions in the fdn 5'-regulatory region delimited
three distinct cis-acting elements. One site, which is located at approximately
-110, was required for nitrate induction. Two other sites share sequence
similarity with the FNR protein binding site core consensus. The first site,
centered at -42.5, was required for anaerobic induction. We used site-specific
mutagenesis to change this putative FNR protein binding site into the CRP
protein binding site core consensus. This change caused the fdn operon to be
expressed aerobically, subject to CRP protein control. On the other hand,
converting this putative FNR protein binding site into the FNR protein binding
site core consensus resulted in elevated anaerobic induction of the fdn operon
and also caused weak aerobic expression. The other putative FNR protein binding
site, centered at -97.5, was not involved in anaerobic induction. It might play
a negative role in fdn operon expression during anaerobic growth in the absence
of nitrate.

PMID: 1629153 [PubMed - indexed for MEDLINE]

275: Mutat Res. 1992 Aug;282(4):247-52. 

UV resistance of E. coli K-12 deficient in cAMP/CRP regulation.

Puyo MF, Calsou P, Salles B.

Laboratoire de Pharmacologie et Toxicologie Fondamentales CNRS, Toulouse,
France.

Deletion of genes for adenylate cyclase (delta cya) or cAMP receptor protein
(delta crp) in E. coli K-12 confers a phenotype that includes resistance to UV
radiation (254 nm). Such mutations lead to UV resistance of uvr+, uvrA, lexA and
recA strains which could partly be abolished by the addition of cAMP to delta
cya but not to delta crp strain culture medium. This effect was not related to
either inducibility of major DNA repair genes or growth rate of the bacteria.
Enhanced survival was also observed for UV-irradiated lambda bacteriophage
indicating that a repair mechanism of UV lesions was involved in this
phenomenon.

PMID: 1379686 [PubMed - indexed for MEDLINE]

276: Proc Natl Acad Sci U S A. 1992 Aug 1;89(15):7056-9. 

Evidence for two promoters upstream of the pts operon: regulation by the cAMP
receptor protein regulatory complex.

Fox DK, Presper KA, Adhya S, Roseman S, Garges S.

McCollum-Pratt Institute, Johns Hopkins University, Baltimore, MD 21218.

Several potential target sites for multiple regulatory mechanisms were
previously identified in the 5' flanking region of the pts operon. We have
investigated the in vitro interactions of the cAMP receptor protein (CRP).cAMP
regulatory complex with two DNA binding sites, by gel mobility-shift assays, and
report the analysis of the functional role of each of the binding sites in vivo.
Promoter-reporter gene fusion studies identified two CRP.cAMP-dependent
promoters (the previously identified P1 and another promoter, P0) upstream of
ptsH. The crr promoters (P2) within ptsI may be negatively regulated by
CRP.cAMP.

PMID: 1323126 [PubMed - indexed for MEDLINE]

277: Nucleic Acids Res. 1992 Jul 11;20(13):3391-6. 

A comparison of the DNA bending activities of the DNA binding proteins CRP and
TFIID.

Gaston K, Bell A, Busby S, Fried M.

Eukaryotic Gene Organisation and Expression Laboratory, Imperial Cancer Research
Fund, Lincoln's Inn Fields, London, UK.

Protein-induced DNA bending is of importance in the formation of complex
nucleoprotein assemblies such as those involved in the initiation of DNA
replication or transcription initiation. We have compared the DNA bending
characteristics of the Escherichia coli cyclic AMP receptor protein (CRP or
CAP), an archetypal DNA bending protein, to those of TFIID, the eukaryotic
TATA-element binding transcription factor. By altering the helical phasing
between a CRP binding site and the E. coli melR promoter we have mapped a DNA
sequence-directed bend in the downstream region of the promoter. This intrinsic
DNA bend may be important in the regulation of the melR promoter by CRP in vivo.
Gel retardation assays and DNAse I footprinting show that human TFIID binds to
the melR promoter - 10 region. Taking advantage of this fact, and using the
CRP-induced DNA bend as a standard, we have employed phase sensitive detection
to show that the DNA bend angle induced by TFIID is far less than that induced
by CRP. Further evidence to support this conclusion comes from a comparison of
the relative mobilities of CRP-DNA and TFIID-DNA complexes. These results place
limits on the role of any DNA bending induced by TFIID alone in the initiation
of transcription.

PMID: 1630910 [PubMed - indexed for MEDLINE]

278: Biochemistry. 1992 Jun 9;31(22):5165-71. 

Solution studies on the structure of bent DNA in the cAMP receptor protein-lac
DNA complex.

Heyduk T, Lee JC.

Department of Human Biological Chemistry and Genetics, University of Texas
Medical Branch, Galveston 77550.

Cyclic AMP receptor protein is involved in the regulation of more than 20 genes.
A step in the mechanism of activation of transcription is to induce a
significant bending of the DNA upon complex formation between specific DNA and
the protein. The induced DNA bending and a structure of the protein-DNA complex
were studied by fluorescence energy transfer in 50 mM Tris, 1 mM EDTA, and 50 mM
KCl at pH 7.8 and 20 degrees C. The symmetry of the DNA bend was estimated by
measuring the efficiency of transfer between the protein and a label on either
the upstream or the downstream end of a lac DNA fragment. The results show that
the bend, despite the asymmetry in the DNA sequence, is symmetrical, for the
fragments which length ranges from 26 to 40 bp. Using fluorescence energy
transfer, the extent of DNA bending was estimated by measuring the end-to-end
distance of the DNA fragment which was labeled with a donor-acceptor pair on two
opposite ends. Both steady-state and time-resolved measurements showed that in a
26 bp lac DNA fragment complexed with cyclic AMP receptor protein, the
end-to-end distance is about 77 A which corresponds to a bending angle of 80
degrees or 100 degrees, depending on the actual contour length between the
fluorophores in the free DNA fragment. The results using longer DNA fragments
show no measurable amount of energy transfer; thus, it is very unlikely that the
DNA completely wraps around the CRP molecule.(ABSTRACT TRUNCATED AT 250 WORDS)

PMID: 1606140 [PubMed - indexed for MEDLINE]

279: J Bacteriol. 1992 Apr;174(7):2111-20. 

Characterization of a fixLJ-regulated Bradyrhizobium japonicum gene sharing
similarity with the Escherichia coli fnr and Rhizobium meliloti fixK genes.

Anthamatten D, Scherb B, Hennecke H.

Mikrobiologisches Institut, Eidgenossische Technische Hochschule, Zurich,
Switzerland.

We describe the cloning, sequencing, regulation, and mutational analysis of a
Bradyrhizobium japonicum fixK-like gene whose product belongs to the family of
Fnr-Crp-related regulatory proteins. The predicted 237-amino-acid FixK protein
was found to share between 28 and 38% sequence identity with the Escherichia
coli Fnr protein, other bacterial Fnr-like proteins (FnrN, Anr, and HlyX), and
two rhizobial FixK proteins. The B. japonicum fixK-like gene, when expressed
from a lac promoter, could functionally complement an fnr mutant strain of E.
coli and activate transcription from an fnr-dependent promoter in the E. coli
background; this activation was sixfold higher in anaerobic cultures than in
aerobically grown cells, a finding that suggested oxygen sensitivity of the FixK
protein and was consistent with the presence of a cysteine-rich, putatively
oxygen-responsive domain at its N-terminal end. Similar to the situation in
Rhizobium meliloti, expression of the fixK gene in B. japonicum was shown to be
induced at low O2 tension and this induction was dependent on the two-component
regulatory system FixLJ. Despite this dependency, however, a B. japonicum fixK
mutant did not have the phenotypic characteristics of B. japonicum fixL and fixJ
mutants: the fixK mutant was neither Fix- in symbiosis with soybean plants nor
defective in anaerobic respiration with nitrate as the terminal electron
acceptor. Also, the fixK mutant was unaffected in the expression of one of the
two B. japonicum sigma 54 genes, rpoN1, which was previously shown to be
controlled by the fixLJ genes. When fixK was introduced into the B. japonicum
fixJ mutant and expressed therein from a constitutive promoter (i.e., uncoupling
it from regulation by FixJ), the FixK protein thus synthesized fully restored
anaerobic nitrate respiration in that strain. We interpret this to mean that the
B. japonicum wild type has two homologs of fixLJ-regulated fixK genes which can
functionally substitute for each other.

PMID: 1551834 [PubMed - indexed for MEDLINE]

280: J Bacteriol. 1992 Apr;174(8):2440-8. 

Cell density-dependent modulation of the Vibrio fischeri luminescence system in
the absence of autoinducer and LuxR protein.

Dunlap PV, Kuo A.

Biology Department, Woods Hole Oceanographic Institution, Massachusetts 02543.

Expression of the Vibrio fischeri luminescence genes (luxR and luxICDABEG) in
Escherichia coli requires autoinducer (N-3-oxohexanoyl homoserine lactone) and
LuxR protein, which activate transcription of luxICDABEG (genes for autoinducer
synthase and the luminescence enzymes), and cyclic AMP (cAMP) and cAMP receptor
protein (CRP), which activate transcription of the divergently expressed luxR
gene. In E. coli and in V. fischeri, the autoinducer-LuxR protein-dependent
induction of luxICDABEG transcription (called autoinduction) is delayed by
glucose, whereas it is promoted by iron restriction, but the mechanisms for
these effects are not clear. To examine in V. fischeri control of lux gene
expression by autoinducer, cAMP, glucose, and iron, lux::Mu dI(lacZ) and lux
deletion mutants of V. fischeri were constructed by conjugation and gene
replacement procedures. beta-Galactosidase synthesis in a luxC::lacZ mutant
exhibited autoinduction. In a luxR::lacZ mutant, complementation by the luxR
gene was necessary for luminescence, and addition of cAMP increased
beta-galactosidase activity four- to sixfold. Furthermore, a luxI::lacZ mutant
produced no detectable autoinducer but responded to its addition with induced
synthesis of beta-galactosidase. These results confirm in V. fischeri key
features of lux gene regulation derived from studies with E. coli. However,
beta-galactosidase specific activity in the luxI::lacZ mutant, without added
autoinducer, exhibited an eight- to tenfold decrease and rise back during
growth, as did beta-galactosidase and luciferase specific activities in the
luxR::lacZ mutant and luciferase specific activity in a delta(luxR luxICD)
mutant. The presence of glucose delayed the rise back in beta-galactosidase and
luciferase specific activities in these strains, whereas iron restriction
promoted it. Thus, in addition to transcriptional control by autoinducer and
LuxR protein, the V. fischeri lux system exhibits a cell density-dependent
modulation of expression that does not require autoinducer, LuxR protein, or
known lux regulatory sites. The response of autoinducer-LuxR protein-independent
modulation to glucose and iron may account for how these environmental factors
control lux gene expressions.

PMID: 1313412 [PubMed - indexed for MEDLINE]

281: J Biol Chem. 1992 Mar 25;267(9):6122-31. 

Structure and regulation of the glpFK operon encoding glycerol diffusion
facilitator and glycerol kinase of Escherichia coli K-12.

Weissenborn DL, Wittekindt N, Larson TJ.

Department of Biochemistry and Nutrition, Virginia Polytechnic Institute and
State University, Blacksburg 24061-0308.

The glpFK operon maps near minute 88 on the linkage map of Escherichia coli K-12
with glpF promoter proximal. The glpF gene encodes a cytoplasmic membrane
protein which facilitates the diffusion of glycerol into the cell. The glpK gene
encodes glycerol kinase. In the present work, the nucleotide sequence of the
5'-end of the operon, including the control region, the glpF gene, and part of
the glpK gene, was determined. The facilitator was predicted to contain 281
amino acids with a calculated molecular weight of 29,780. It is a highly
hydrophobic protein with a minimum of six potential transmembrane alpha helices.
The transcription start site for the glpFK operon was located 71 base pairs
upstream from the proposed translation start codon for glpF. Preceding the
transcription start site were sequences similar to the -10 and -35 consensus
sequences for bacterial promoters. Binding sites for the cAMP-cAMP receptor
protein (CRP) complex and the glp repressor were identified by DNase I
footprinting. The region protected by the cAMP.CRP complex contained tandem
sequences resembling the consensus sequence for CRP binding. The CRP sites were
centered at 37.5 and 60.5 base pairs upstream of the start of transcription. The
glp repressor protected an extensive area (-89 to -7 relative to the start point
of transcription), sufficient for the binding of four repressor tetramers. Two
additional binding sites for the repressor were identified within the glpK
coding region. The DNA containing these two operators synergistically increased
the apparent affinity of glp repressor for DNA fragments containing the four
operators in the promoter region of the glpFK operon. With this study, a total
of 13 operators for the glp regulon have been characterized. Comparison of these
operators revealed the consensus 5'-WATGTTCGWT-3' for the operator half-site (W
= A or T). The relative affinity of the glp repressor for the various glp
operators was assessed in vivo using a promoter-probe vector. The relative
apparent affinity of the control regions for glp repressor was glpFK greater
than glpD greater than glpACB greater than glpTQ. The degree of catabolite
repression for each of the operons was assessed using a similar system. In this
case, the relative sensitivity of the glp operons to catabolite repression was
glpTQ greater than glpFK greater than glpACB greater than glpD.

PMID: 1372899 [PubMed - indexed for MEDLINE]

282: J Mol Biol. 1992 Mar 20;224(2):293-306. 

Upstream curved sequences influence the initiation of transcription at the
Escherichia coli galactose operon.

Lavigne M, Herbert M, Kolb A, Buc H.

Unite de Physicochimie des Macromolecules Biologiques (URA 1149 du CNRS)
Institut Pasteur, Paris, France.

The two overlapping promoters that control mRNA synthesis at the galactose
operon contain three phased stretches of adenine residues, located around
positions -84.5, -74 and -63, with respect ot the start of the P1 promoter. As a
result, the corresponding DNA sequence is bent, an anomaly that is relieved by
the addition of small concentrations of drugs like distamycin A or netropsin. By
abortive initiation assays performed on several DNA fragments derived from the
wild-type promoter or from various mutants we show that the curved sequence
increases the strength of the P1 promoter. In the absence of cyclic AMP (cAMP)
and of the corresponding receptor protein (CRP), the upstream curved sequences
enhance the rate of isomerization from the closed to the open complex at P1.
This effect is abolished when distamycin A is bound in the bent region. In the
presence of cAMP-CRP, a more drastic change is observed: activation of the gal
P1 promoter takes place at a different formal step, depending whether the
upstream curved sequence is present or not (enhancement of the rate of
conversion from a closed to an open complex instead of an increase in the
affinity of the enzyme during closed complex formation). These data, together
with previous results obtained with other mutants of the gal control region,
suggest that several closed complexes corresponding to different nucleoprotein
arrangements are formed during open complex formation at gal P1, in the presence
of CRP.

PMID: 1313883 [PubMed - indexed for MEDLINE]

283: J Bacteriol. 1992 Feb;174(3):664-70. 

Positive and negative control of ompB transcription in Escherichia coli by
cyclic AMP and the cyclic AMP receptor protein.

Huang L, Tsui P, Freundlich M.

Department of Biochemistry and Cell Biology, State University of New York, Stony
Brook 11794-5215.

The ompB operon encodes OmpR and EnvZ, two proteins that are necessary for the
expression and osmoregulation of the OmpF and OmpC porins in Escherichia coli.
We have used in vitro and in vivo experiments to show that cyclic AMP and the
cyclic AMP receptor protein (CRP) directly regulate ompB. ompB expression in an
ompB-lacZ chromosomal fusion strain was increased two- to fivefold when cells
were grown in medium containing poor carbon sources or with added cyclic AMP. In
vivo primer extension analysis indicated that this control is complex and
involves both positive and negative effects by cyclic AMP-CRP on multiple ompB
promoters. In vitro footprinting showed that cyclic AMP-CRP binds to a 34-bp
site centered at -53 and at -75 in relation to the start sites of the major
transcripts that are inhibited and activated, respectively, by this complex.
Site-directed mutagenesis of the crp binding site provided evidence that this
site is necessary for the in vivo regulation of ompB expression by cyclic AMP.
Control of the ompB operon by cyclic AMP-CRP may account for the observed
regulation of the formation of OmpF and OmpC by this complex (N. W. Scott and C.
R. Harwood, FEMS Microbiol. Lett. 9:95-98, 1980).

PMID: 1310090 [PubMed - indexed for MEDLINE]

284: Biochim Biophys Acta. 1991 Dec 2;1129(1):109-11. 

The nucleotide sequence of the Escherichia coli crp divergent RNA and an
overlapping ORF.

Bhasin R, Freundlich M.

Department of Biochemistry and Cell Biology, State University of New York, Stony
Brook 11794.

The nucleotide sequence specifying the crp divergent RNA of Escherichia coli was
determined. An open reading frame (ORF) is located at +135 to +536 relative to
the initiation site of the divergent RNA. Potential factor independent
transcription terminators were found at +257 to +294 and +544 to +576. These
putative termination sites may account for the two RNAs of approximately 300 and
550 nucleotides previously identified as originating from the crp divergent
promoter.

PMID: 1756168 [PubMed - indexed for MEDLINE]

285: Mol Gen Genet. 1991 Dec;231(1):76-80. 

Restored DNA-binding of the cAMP-CRP activator complex reestablishes negative
regulation by the CytR repressor in the deoP2 promoter in Escherichia coli.

Sogaard-Andersen L, Valentin-Hansen P.

Department of Molecular Biology, Odense University, Denmark.

We have investigated in vivo the coupling between CytR regulation of the deoP2
promoter in Escherichia coli and the DNA-binding specificity of the cAMP-CRP
(cAMP receptor protein) complex in order to obtain a more detailed picture of
the role played by cAMP-CRP in CytR regulation. By introducing CRP proteins that
exhibit an altered DNA binding specificity into a strain containing a mutant
deoP2 promoter in which cAMP-CRP activation was decreased and CytR regulation
completely abolished, we show that CytR regulation of this promoter can be
reestablished by restored the DNA binding of the cAMP-CRP complex. Hence, CytR
regulation of deoP2 can be modulated by simply varying DNA binding of cAMP-CRP.
These data confirm the crucial role played by the cAMP-CRP activator complex in
CytR regulation of the deoP2 promoter.

PMID: 1661372 [PubMed - indexed for MEDLINE]

286: J Mol Biol. 1991 Nov 20;222(2):189-96. 

An Escherichia coli rpoB mutation that inhibits transcription of
catabolite-sensitive operons.

Rockwell P, Gottesman ME.

Institute of Cancer Research, College of Physicians and Surgeons of Columbia
University, New York, NY 10032.

The Escherichia coli rpoB636 mutant is defective in the transcription of lac and
other catabolite-sensitive operons. The lac promoter variant, UV5, which is
independent of cyclic AMP and the cyclic AMP receptor protein, CRP, was also
defective in rpoB636 mutants. The activity of the lac UV5 promoter was restored
to wild-type levels by deletion of cya (adenylate cyclase) or crp. Cyclic AMP
and CRP apparently act as inhibitors of the rpoB636 RNA polymerase.

PMID: 1660071 [PubMed - indexed for MEDLINE]

287: Mol Gen Genet. 1991 Nov;230(1-2):28-32. 

Carbon-starvation induction of the ugp operon, encoding the binding
protein-dependent sn-glycerol-3-phosphate transport system in Escherichia coli.

Su TZ, Schweizer HP, Oxender DL.

Department of Biological Chemistry, University of Michigan, Ann Arbor
48109-0606.

The gene products of the ugp operon of Escherichia coli are responsible for the
uptake of sn-glycerol-3-phosphate and certain glycerophosphodiesters. The
regulation of ugp is mainly phoBR-dependent. Significant expression, however,
can be observed even in the presence of high concentrations of phosphate, a
condition which normally completely represses pho expression. Pho-independent
ugp expression was found to be derepressed during the late logarithmic growth
phase due to carbon starvation. Among different carbon sources tested, glucose
caused the most complete repression. Addition of cAMP prevented glucose
repression, indicating that a cAMP-CRP control mechanism may be directly or
indirectly involved in the carbon-starvation response. This conclusion is
supported by the fact that pho-independent ugp expression correlated with the
presence of the cya and crp gene products.

PMID: 1745236 [PubMed - indexed for MEDLINE]

288: Res Microbiol. 1991 Nov-Dec;142(9):937-42. 

Genetic studies on the promoter of malT, the gene that encodes the activator of
the Escherichia coli maltose regulon.

Raibaud O, Vidal-Ingigliardi D, Kolb A.

Unite de Genetique moleculaire, Institut Pasteur (URA 1149 du CNRS), Paris.

We report the construction of a chromosomal malT-lacZ gene fusion that is
expressed under the control of the malT promoter in Escherichia coli K12. The
resulting hybrid protein is soluble and stable in crude cellular extracts, which
allowed us to measure very low levels of malTp activity. In this note, we
confirm and extend previous observations on the regulation of malTp. We show
that the promoter is 40-times less active in the absence of cAMP receptor
protein (CRP) than in its presence, that CRP works by binding to the site
centred at position -70.5, and that all of the elements necessary and sufficient
for the regulation by CRP are located downstream from position -122.

PMID: 1666689 [PubMed - indexed for MEDLINE]

289: Proc Natl Acad Sci U S A. 1991 Oct 15;88(20):8958-62. 

Functional map of the alpha subunit of Escherichia coli RNA polymerase: two
modes of transcription activation by positive factors.

Igarashi K, Hanamura A, Makino K, Aiba H, Aiba H, Mizuno T, Nakata A, Ishihama
A.

National Institute of Genetics, Department of Molecular Genetics, Shizuoka,
Japan.

The role of the alpha subunit of Escherichia coli RNA polymerase in
transcription activation by positive factors was investigated using two
reconstituted mutant RNA polymerases (containing C-terminally truncated alpha
subunits) and three positive factors [the cAMP receptor protein (CRP), OmpR, and
PhoB]. The mutant RNA polymerases did not respond to transcription activation by
activator proteins that bind upstream of the respective promoters. Transcription
by these mutant enzymes was, however, activated in the cases where activators
bind to target sites that overlap the promoter -35 region. Two different
mechanisms are proposed for the positive control of transcription by activator
proteins, one requiring the C-terminal domain of the alpha subunit, and the
other not requiring it.

PMID: 1833768 [PubMed - indexed for MEDLINE]

290: Mol Microbiol. 1991 Oct;5(10):2503-9. 

Environmentally regulated algD promoter is responsive to the cAMP receptor
protein in Escherichia coli.

DeVault JD, Hendrickson W, Kato J, Chakrabarty AM.

Department of Microbiology and Immunology (M/C 790), University of Illinois
College of Medicine, Chicago 60612.

The environmentally activated algD promoter of Pseudomonas aeruginosa has been
shown to be influenced by DNA supercoiling. It is believed that protein-induced
bending or looping is required for this activation. We studied the role of
Escherichia coli cAMP-CRP on algD promoter activation in E. coli and show that a
functional CRP is required for this activation. We also demonstrate that the
algD promoter is sensitive to glucose repression both in E. coli and P.
aeruginosa. Deletion of a putative consensus CRP binding sequence upstream of
the algD promoter renders the promoter non-responsive to glucose repression. The
involvement of cAMP-CRP complex in the activation of the algD promoter in E.
coli has been demonstrated directly through binding of a 255 base pair DNA
fragment containing the putative consensus CRP binding sequence. Other
fragments, upstream or downstream but without any consensus CRP binding
sequence, did not show any binding with CRP. A CRP-like analogue, similar to
that in Xanthomonas campestris, but capable of activating genes without forming
a complex with cAMP, is believed to allow glucose repression in P. aeruginosa.

PMID: 1665196 [PubMed - indexed for MEDLINE]

291: J Bacteriol. 1991 Oct;173(20):6626-31. 

Klebsiella aerogenes catabolite gene activator protein and the gene encoding it
(crp).

Osuna R, Bender RA.

Department of Biology, University of Michigan, Ann Arbor 48109-1048.

The catabolite gene activator protein from Klebsiella aerogenes (CAPK) and the
corresponding protein from Escherichia coli (CAPE) were shown to be nearly
identical. Both CAPK and CAPE activated transcription from the CAP-dependent
promoters derived from E. coli and K. aerogenes. The crp gene from K. aerogenes
(encoding CAP) is tightly linked to rpsL. The nucleotide sequence of crp
predicts an amino acid sequence for CAPK that differs in only one position from
that of CAPE.

PMID: 1655718 [PubMed - indexed for MEDLINE]

292: Cell. 1991 Sep 20;66(6):1185-95. 

A new mechanism for coactivation of transcription initiation: repositioning of
an activator triggered by the binding of a second activator.

Richet E, Vidal-Ingigliardi D, Raibaud O.

Unite de Genetique Moleculaire URA 1149 du CNRS, Institut Pasteur, Paris,
France.

The cAMP receptor protein (CRP) and MaIT, the maltose regulon activator,
synergistically activate transcription from the E. coli maIKp promoter. The
maIKp regulatory region comprises two series of MaIT-binding sites separated by
three CRP-binding sites. By combining genetic and biochemical studies, we
demonstrate that the promoter-proximal region contains two overlapping sets of
three MaIT-binding sites. Occupation of the higher affinity set of sites, which
occurs in the absence of CRP, does not lead to malKp activation. In contrast, in
the presence of CRP, MalT binds to the lower affinity set of sites and triggers
transcription initiation because, unlike the high affinity set, the low affinity
set of sites is properly positioned with respect to the Pribnow box. The CRP
effect requires the malKp-distal MalT-binding sites. The synergistic action of
MalT and CRP therefore relies on MalT repositioning via the formation of a
nucleoprotein structure involving the entire regulatory region.

PMID: 1913806 [PubMed - indexed for MEDLINE]

293: Nucleic Acids Res. 1991 Aug 25;19(16):4413-9. 

Molecular mechanism of negative autoregulation of Escherichia coli crp gene.

Hanamura A, Aiba H.

Institute of Biological Sciences, University of Tsukuba, Ibaraki, Japan.

Transcription of the Escherichia coli crp gene encoding cAMP receptor protein
(CRP) is negatively regulated by CRP-cAMP complex that binds to a specific site
located downstream from the transcription start site. The binding of CRP-cAMP to
this site activates transcription from a second divergent overlapping promoter.
The mechanism of this negative autoregulation of the crp gene has been
investigated by in vitro transcription, gel shift, DNase I footprinting, and
exonuclease III protection assays. We demonstrated that the crp and divergent
promoters are reciprocally and coordinately regulated by CRP-cAMP. The abortive
initiation assay revealed that the divergent RNA itself is not required for the
inhibition of crp transcription. Detailed binding studies revealed that CRP-cAMP
stimulates the binding of RNA polymerase to the divergent promoter and thus
blocks the occupation of the crp promoter by RNA polymerase.

PMID: 1715982 [PubMed - indexed for MEDLINE]

294: Cell. 1991 Jun 14;65(6):1015-22. 

Bipartite functional map of the E. coli RNA polymerase alpha subunit:
involvement of the C-terminal region in transcription activation by cAMP-CRP.

Igarashi K, Ishihama A.

Department of Molecular Genetics, National Institute of Genetics, Mishima,
Shizuoka, Japan.

The alpha subunit of Escherichia coli RNA polymerase plays a major role in the
subunit assembly. Carboxyterminal deletion derivatives lacking 73 or 94 amino
acid residues were assembled in vitro into enzyme molecules. Core enzymes
consisting of these C-terminal-truncated alpha subunits were as active in RNA
synthesis as native core enzyme. By the addition of sigma 70 subunit, these
mutant enzymes initiated transcription from certain promoters. The mutant RNA
polymerases, however, did not show cAMP-CRP activated transcription. These
results demonstrate that the N-terminal region of the alpha subunit is involved
in the formation of active enzyme molecule, while the C-terminal region plays an
essential role in response to transcription activation by cAMP-CRP.

PMID: 1646077 [PubMed - indexed for MEDLINE]

295: Proc Natl Acad Sci U S A. 1991 Jun 1;88(11):4921-5. 

Single amino acid substitutions in the cAMP receptor protein specifically
abolish regulation by the CytR repressor in Escherichia coli.

Sogaard-Andersen L, Mironov AS, Pedersen H, Sukhodelets VV, Valentin-Hansen P.

Department of Molecular Biology, Odense University, Denmark.

Promoters in Escherichia coli that are negatively regulated by the CytR
repressor are also activated by the cAMP receptor protein (CRP) complexed to
cAMP; as a characteristic, these promoters encode tandem binding sites for
cAMP-CRP. In one such promoter, deoP2, CytR binds to the region between the
tandem CRP binding sites with a relatively low affinity; in the presence of
cAMP-CRP, however, the repressor and activator bind cooperatively to the DNA.
Here we have investigated this cooperativity by isolating mutants of the CRP
protein that abolish CytR regulation without exhibiting a concomitant loss in
their ability to activate transcription. Four different, single amino acid
substitutions in CRP give rise to this phenotype. These amino acids lie in close
proximity on the surface of the CRP tertiary structure in a portion of the
protein that is not in contact with the DNA. In vitro analyses of one of the CRP
mutants show that it interacts with the DNA in a manner indistinguishable from
wild-type CRP, whereas its interaction with CytR is perturbed. These results
strongly indicate that cooperative DNA binding of CytR and cAMP-CRP is achieved
through protein-protein interactions.

PMID: 1647022 [PubMed - indexed for MEDLINE]

296: J Bacteriol. 1991 Jun;173(12):3615-21. 

Cyclic AMP inhibits and putrescine represses expression of the speA gene
encoding biosynthetic arginine decarboxylase in Escherichia coli.

Moore RC, Boyle SM.

Department of Pathobiology, Virginia-Maryland Regional College of Veterinary
Medicine, Virginia Polytechnic Institute and State University, Blacksburg 24061.

The speA gene of Escherichia coli encodes biosynthetic arginine decarboxylase
(ADC), the first of two enzymes in a putrescine biosynthetic pathway. The
activity of ADC is negatively regulated by mechanisms requiring cyclic AMP
(cAMP) and cAMP receptor protein (CRP) or putrescine. A 2.1-kb BamHI fragment
containing the speA-metK intergenic region, speA promoter, and 1,389 bp of the
5' end of the speA coding sequence was used to construct transcriptional and
translational speA-lacZ fusion plasmids. A single copy of either type of
speA-lacZ fusion was transferred into the chromosomes of Escherichia coli
KC14-1, CB806, and MC4100, using bacteriophage lambda. The speA gene in
lysogenized strains remained intact and served as a control. Addition of 5 mM
cAMP to lysogenic strains resulted in 10 to 37% inhibition of ADC activity,
depending on the strain used. In contrast, the addition of 5 or 10 mM cAMP to
these strains did not inhibit the activity of beta-galactosidase (i.e.,
ADC::beta-galactosidase). Addition of 10 mM putrescine to lysogenized strains
resulted in 24 to 31% repression of ADC activity and 41 to 47% repression of
beta-galactosidase activity. E. coli strains grown in 5 mM cAMP and 10 mM
putrescine produced 46 to 61% less ADC activity and 41 to 52% less
beta-galactosidase activity. cAMP (0.1 to 10 mM) did not inhibit ADC activity
assayed in vitro. The effects of cAMP and putrescine on ADC activity were
additive, indicating the use of independent regulatory mechanisms. These results
show that cAMP acts indirectly to inhibit ADC activity and that putrescine
causes repression of speA transcription.

PMID: 1646785 [PubMed - indexed for MEDLINE]

297: J Mol Biol. 1991 Apr 5;218(3):529-42. 

Supercoiling is essential for the formation and stability of the initiation
complex at the divergent malEp and malKp promoters.

Richet E, Raibaud O.

Unite de Genetique Moleculaire, URA 1149 du CNRS, Institut Pasteur, Paris,
France.

malEp and malKp are divergent and partially overlapping promoters of the
Escherichia coli maltose regulon, whose activity depends on the presence of two
transcriptional activators. MalT and CRP (cAMP receptor protein). Their
activation involves a common 210 base-pair regulatory region encompassing
multiple binding sites for both activators. Using a supercoiled plasmid
containing malEp and malKp as template, purified proteins and a single-round
transcription assay, we developed an in vitro system in which both promoters
behave as in vivo. In this system, malEp and malKp are active only in the
presence of both MalT and CRP, and various mutations in the MalT or CRP binding
sites affect the promoters in the same way as they do in vivo. We showed that
supercoiling plays a crucial role not only for the formation of the initiation
complex at malEp and malKp but also for its stability. In addition,
dimethylsulphate protection experiments provide evidence that the nucleoprotein
complexes formed by CRP and MalT bound to malEp and malKp on supercoiled and
relaxed DNA are different. We speculate that one of the roles of supercoiling
might be to assist the assembly of a preinitiation complex involving the
regulatory region DNA and several molecules of MalT and CRP.

PMID: 2016744 [PubMed - indexed for MEDLINE]

298: J Bacteriol. 1991 Apr;173(8):2644-8. 

Nucleotide sequence and characterization of the sfs1 gene: sfs1 is involved in
CRP*-dependent mal gene expression in Escherichia coli.

Kawamukai M, Utsumi R, Takeda K, Higashi A, Matsuda H, Choi YL, Komano T.

Laboratory of Applied Microbiology, Faculty of Agriculture, Shimane University,
Matsue, Japan.

We have cloned at least 12 different Escherichia coli genes which enable strain
MK2001 to use maltose. The genes were designated sfs1 through sfs12 (sugar
fermentation stimulation). Previously, one (sfs7) of them was mapped at 65 min
on the E. coli chromosome and identified as nlp, which has high homology to
repressor protein (Ner) of Mu phage, which contains a putative DNA binding
region (Y.-L. Choi, T. Nishida, M. Kawamukai, R. Utsumi, H. Sakai, and T.
Komano, J. Bacteriol. 171:5222-5225, 1989). In this study, another gene (sfs1)
located at 3.5 min was newly found and analyzed. The nucleotide sequence of sfs1
encoded a protein of 234 amino acids (molecular mass, 26,227 Da) which also has
a putative DNA binding domain. Overexpression of the sfs1 gene in MK2001
resulted in a 10-fold increase of amylomaltase, which was still dependent on
MalT. These results suggest that Sfs1 could be a new regulatory factor involved
in maltose metabolism.

PMID: 2013578 [PubMed - indexed for MEDLINE]

299: Mol Microbiol. 1991 Apr;5(4):969-75. 

A novel function of the cAMP-CRP complex in Escherichia coli: cAMP-CRP functions
as an adaptor for the CytR repressor in the deo operon.

Sogaard-Andersen L, Pedersen H, Holst B, Valentin-Hansen P.

Department of Molecular Biology, Odense University, Denmark.

Unlike classical bacterial repressors, the CytR repressor of Escherichia coli
cannot independently regulate gene expression. Here we show that CytR binding to
the deoP2 promoter relies on interaction with the master gene regulatory
protein, CRP, and, furthermore, that cAMP-CRP and CytR bind co-operatively to
deoP2. Using mutant promoters we show that tandem, properly spaced DNA-bound
cAMP-CRP complexes are required for this co-operative binding. These data
suggest that CytR forms a bridge between tandem cAMP-CRP complexes, and that
cAMP-CRP functions as an adaptor for CytR. The implications of this new version
of negative control in E. coli on bacterial gene expression and on combinatorial
gene regulation in higher organisms are discussed.

PMID: 1649947 [PubMed - indexed for MEDLINE]

300: Mol Microbiol. 1991 Feb;5(2):433-7. 

Design of cAMP-CRP-activated promoters in Escherichia coli.

Valentin-Hansen P, Holst B, Sogaard-Andersen L, Martinussen J, Nesvera J,
Douthwaite SR.

Department of Molecular Biology, University of Odense, Denmark.

We have studied the deoP2 promoter of Escherichia coli to define features that
are required for optimal activation by the complex of adenosine 3',5'
monophosphate (cAMP) and the cAMP receptor protein (CRP). Systematic mutagenesis
of deoP2 shows that the distance between the CRP site and the -10 hexamer is the
crucial factor in determining whether the promoter is activated by cAMP-CRP.
Based on these observations, we propose that cAMP-CRP-activated promoters can be
created by correctly aligning a CRP target and a -10 hexamer. This idea has been
successfully tested by converting both a CRP-independent promoter and a sequence
resembling the consensus -10 hexamer to strongly cAMP-CRP-activated promoters.

PMID: 1645842 [PubMed - indexed for MEDLINE]

301: J Biol Chem. 1991 Jan 25;266(3):1721-7. 

Transcriptional terminator is a positive regulatory element in the expression of
the Escherichia coli crp gene.

Aiba H, Hanamura A, Yamano H.

Department of Chemistry, University of Tsukuba, Ibaraki, Japan.

Plasmids were constructed that contain deletions in the stem region of the
presumed rho-independent terminator of the cloned crp gene of Escherichia coli.
The level of cyclic AMP binding activity and the amount of CRP in cells
harboring the deletion plasmids were found to be significantly lower than those
in cells harboring the wild-type crp plasmid. Quantitative S1 assays indicated
that the steady-state levels of crp mRNA were markedly reduced in cells
harboring the deletion plasmids. Evidence was also presented to show that the
crp mRNAs produced from deletion plasmids are less stable than that from the
intact crp gene. In vitro transcription assays revealed that the putative crp
terminator is indeed a rho-independent terminator. Using the galK expression
system and Northern blot analysis we showed that the crp terminator is
functional in vivo. Moreover it was shown that the deletion mutations in the
stem region of the crp terminator cause a significant readthrough. We conclude
that the 3'-flanking sequence of the crp gene acts to stabilize its own mRNA as
well as to terminate transcription.

PMID: 1703152 [PubMed - indexed for MEDLINE]

302: Biochim Biophys Acta. 1991 Jan 17;1088(1):31-5. 

Regulation of glpD and glpE gene expression by a cyclic AMP-cAMP receptor
protein (cAMP-CRP) complex in Escherichia coli.

Choi YL, Kawase S, Kawamukai M, Sakai H, Komano T.

Department of Agricultural Chemistry, Kyoto University, Japan.

The glpE gene of E. coli was found to be transcribed divergently with respect to
glpD, which is adjacent to glpE head-to-head on the E. coli chromosome. We
constructed glpD- and/or glpE-lacZ fusion plasmids, which provided glpD and lacZ
as reporter genes. The expression of glpD and glpE, under the control of the
cAMP-CRP complex, was examined by measuring the activities in E. coli cells of
beta-galactosidase encoded by lacZ and glycerol-3-phosphate dehydrogenase
encoded by glpD. In the double-reporter-gene system, the expression of glpD and
glpE was found to be positively regulated by cAMP-CRP. We also confirmed that
intracellular levels of the translation products and the transcripts from glpD
and glpE were positively regulated by cAMP-CRP. The cAMP-mediated induction of
gene expression of glpD and glpE was significantly affected by structural
alterations of the single CRP-binding site between glpD and glpE. These results
indicate that the single CRP-binding site is a cis-acting element involved in
the positive regulation of the expression of both glpD and glpE at the
transcriptional level.

PMID: 1846566 [PubMed - indexed for MEDLINE]

303: J Bacteriol. 1991 Jan;173(2):549-58. 

Dual regulation of the ugp operon by phosphate and carbon starvation at two
interspaced promoters.

Kasahara M, Makino K, Amemura M, Nakata A, Shinagawa H.

Department of Experimental Chemotherapy, Osaka University, Japan.

The ugp operon of Escherichia coli includes genes involved in the uptake of
sn-glycerol-3-phosphate and glycerophosphoryl diesters and belongs to the pho
regulon which is induced by phosphate limitation. This operon has two
transcriptional initiation sites, as determined by S1 nuclease mapping of the in
vivo transcripts. The downstream promoter has multiple copies of the pho box,
the consensus sequence shared by the pho promoters; the upstream promoter has a
consensus sequence for the promoters regulated by cyclic AMP and its receptor
protein, CRP. PhoB protein, which is the transcriptional activator for the pho
regulon, protected the regulatory region with the pho boxes in DNase I
footprinting experiments and activated transcription from the downstream
promoter in vitro. Studies with transcriptional fusions between ugp and a
promoterless gene for chloramphenicol acetyltransferase show that the upstream
promoter is induced by carbon starvation in a manner that required the cya and
crp genes. PhoB protein may act as a repressor for this upstream promoter, which
also overlaps the upstream third pho box. The downstream promoter was induced by
phosphate starvation and requires the PhoB protein for its activation as do the
other pho regulon promoters. These results suggest that the two promoters
function alternately in responding to phosphate or carbon starvation, thus
providing the cell with a means to adapt to these physiological stresses.

PMID: 1987150 [PubMed - indexed for MEDLINE]

304: Proc Natl Acad Sci U S A. 1991 Jan 1;88(1):229-33. 

Three adjacent binding sites for cAMP receptor protein are involved in the
activation of the divergent malEp-malKp promoters.

Vidal-Ingigliardi D, Raibaud O.

Unite de Genetique Moleculaire, URA 1149 du Centre National de la Recherche
Scientifique, Institut Pasteur, Paris, France.

The divergent malEFG and malK-lamB-malM operons in Escherichia coli are
controlled by partially overlapping promoters, whose activity depends on the
presence of two transcriptional activators, MalT and the cAMP receptor protein
(CRP). The 271-base-pair region separating the transcription start points of the
promoters malEp and malKp comprises a compact array of binding sites for MalT
and CRP. We report the characterization of the in vitro interactions of CRP with
its four adjacent binding sites and the analysis of their function in vivo. By
using the DNase I footprinting technique, we showed that CRP binds with high
affinity to the three malEp-proximal sites and with a low affinity to the fourth
site. CRP binding to these sites is not cooperative, even though they are
adjacent and located on the same face of the DNA double helix. Each of these
sites was destroyed by localized mutagenesis and the residual activity of the
promoters was measured in vivo. Mutations in any of the three high-affinity
binding sites reduced both malEp and malKp activity. The participation of
several adjacent bound CRP molecules in the activation of a promoter is an
unprecedented observation and might involve molecular mechanisms quite different
from those used in the other CRP-controlled promoters.

PMID: 1824723 [PubMed - indexed for MEDLINE]

305: Res Microbiol. 1991 Jan;142(1):29-36. 

Erratum in:
    Res Microbiol 1991 May;142(4):482.

Are appR and katF the same Escherichia coli gene encoding a new sigma
transcription initiation factor?

Touati E, Dassa E, Dassa J, Boquet PL, Touati D.

Service de Biochimie des Proteines, CEN Saclay, Gif-sur-Yvette, France.

The phenotype of Escherichia coli appR pleiotropic mutants has been compared
with that of mutants in the katF gene, which lies in the same region and
controls expression of catalase HPII (katE) and exonuclease III (xth). All the
described characters of appR mutants--reduced pH 2.5 acid phosphatase level,
overexpression of alkaline phosphatase and ability of crp or cya mutants to
utilize some CAP + cAMP-dependent carbon sources--were reproduced by a katF::
Tn10 insertion. In all cases, the wild-type phenotype was restored by the
presence of a plasmid-borne katF+ gene. Conversely, spontaneous appR mutants
were hypersensitive to H2O2 to the same degree as katF mutants. We conclude that
the appR gene is identical to katF, which encodes a putative new sigma factor
(Mulvey and Loewen, 1989).

PMID: 1648776 [PubMed - indexed for MEDLINE]

306: Nucleic Acids Res. 1990 Dec 25;18(24):7243-50. 

Mutations that alter the ability of the Escherichia coli cyclic AMP receptor
protein to activate transcription.

Bell A, Gaston K, Williams R, Chapman K, Kolb A, Buc H, Minchin S, Williams J,
Busby S.

School of Biochemistry, University of Birmingham, UK.

The effects of a number of mutations in the E. coli cyclic AMP receptor protein
(CRP) have been determined by monitoring the in vivo expression and in vitro
open complex formation at two semi-synthetic promoters that are totally
CRP-dependent. At one promoter the CRP-binding site is centered around 41.5 base
pairs upstream from the transcription start whilst at the other promoter it is
61.5 base pairs upstream. The CRP mutation E171K reduces expression from both
promoters whilst H159L renders CRP totally inactive: neither mutation stops CRP
binding at either promoter. The mutations K52N and K52Q reverse the effect of
H159L and 'reeducate' CRP to activate transcription. CRP carrying both H159L and
K52N activates transcription from the promoter with the CRP site at -41.5 better
than wild type CRP. In sharp contrast, this doubly changed CRP is totally
inactive with respect to the activation of transcription from the promoter
carrying the CRP site at -61.5. Our results suggest that CRP can use different
contacts and/or conformations during transcription activation at promoters with
different architectures.

PMID: 2259621 [PubMed - indexed for MEDLINE]

307: J Bacteriol. 1990 Dec;172(12):6651-60. 

Growth-phase-dependent expression of the Pseudomonas putida TOL plasmid pWW0
catabolic genes.

Hugouvieux-Cotte-Pattat N, Kohler T, Rekik M, Harayama S.

Department of Medical Biochemistry, Faculty of Medicine, University of Geneva,
Switzerland.

Pseudomonas putida TOL plasmid pWW0 catabolic genes are clustered into two
operons. The first, the upper operon, is controlled by the xylR regulatory gene,
whereas the second, the meta operon, is controlled by the xylS regulatory gene.
The xylS gene itself is subjected to control by xylR. In this study, we show
that the TOL catabolic operons were poorly induced in cells growing at the
early-exponential-growth phase but strongly induced in cells at
late-exponential-growth phase. We constructed fusions of four TOL promoters, Pm
(the promoter of the meta operon), Pu (the promoter of the upper operon), Ps
(the promoter of the xylS regulatory gene), and Pr (the promoter of the xylR
regulatory gene) with lacZ and examined, in Escherichia coli and P. putida, the
expression of these promoters in relation to the growth phase. Expression from
Pm, Pu, Ps, and Pr was almost constant if the host cells did not carry either
xylS or xylR. Similarly, expression of Pm and Pu in P. putida in the absence of
XylS and XylR was constant during the growth of the cells. XylS-dependent
transcription of Pm and XylR-dependent transcription of Ps and Pu, in contrast,
varied with the growth phase. This observation suggested that the interaction of
XylS and XylR with target promoters or with RNA polymerases was influenced by
the growth phase. The nature of the signal which triggers the
growth-phase-dependent regulation was not clear. A change in the oxygen partial
pressure was not responsible for the regulation. E. coli mutants defective in
relA, crp, and cya exhibited growth-phase-dependent expression of the TOL
catabolic genes, indicating that cyclic AMP and relA-dependent synthesis of
ppGpp are not involved in this phenomenon.

PMID: 2254244 [PubMed - indexed for MEDLINE]

308: Mol Microbiol. 1990 Nov;4(11):1831-8. 

Interconversion of the DNA-binding specificities of two related transcription
regulators, CRP and FNR.

Spiro S, Gaston KL, Bell AI, Roberts RE, Busby SJ, Guest JR.

Department of Molecular Biology and Biotechnology, University of Sheffield, UK.

In Escherichia coli, FNR and CRP are homologous transcriptional regulators which
recognize similar nucleotide sequences via DNA-binding domains containing
analogous helix-turn-helix motifs. The molecular basis for recognition and
discrimination of their target sites has been investigated by directed amino
acid substitutions in the corresponding DNA-recognition helices. In FNR, Glu-209
and Ser-212 are essential residues for the recognition of FNR sites. A V208R
substitution confers CRP-site specificity without loss of FNR specificity, but
this has adverse effects on anaerobic growth. In contrast, changes at two (V208R
and E209D) or three (V208R, S212G and G216K) positions in FNR endow a single
CRP-site binding specificity. In reciprocal experiments, two substitutions
(R180V and G184S) were required to convert the binding specificity of CRP to
that of FNR. Altering Asp-199 in FNR failed to produce a positive control
phenotype, unlike substitutions at the comparable site in CRP. Implications for
the mechanism of sequence discrimination by FNR and CRP are discussed.

PMID: 2136332 [PubMed - indexed for MEDLINE]

309: J Bacteriol. 1990 Oct;172(10):5877-83. 

A Xanthomonas campestris pv. campestris protein similar to catabolite activation
factor is involved in regulation of phytopathogenicity.

de Crecy-Lagard V, Glaser P, Lejeune P, Sismeiro O, Barber CE, Daniels MJ,
Danchin A.

Unite de Regulation de l'Expression Genetique, Institut Pasteur, Paris, France.

A DNA fragment from Xanthomonas campestris pv. campestris that partially
restored the carbohydrate fermentation pattern of a cya crp Escherichia coli
strain was cloned and expressed in E. coli. The nucleotide sequence of this
fragment revealed the presence of a 700-base-pair open reading frame that coded
for a protein highly similar to the catabolite activation factor (CAP) of E.
coli (accordingly named CLP for CAP-like protein). An X. campestris pv.
campestris clp mutant was constructed by reverse genetics. This strain was not
affected in the utilization of various carbon sources but had strongly reduced
pathogenicity. Production of xanthan gum, pigment, and extracellular enzymes was
either increased or decreased, suggesting that CLP plays a role in the
regulation of phytopathogenicity.

PMID: 2170330 [PubMed - indexed for MEDLINE]

310: J Bacteriol. 1990 Oct;172(10):5706-13. 

The CytR repressor antagonizes cyclic AMP-cyclic AMP receptor protein activation
of the deoCp2 promoter of Escherichia coli K-12.

Sogaard-Andersen L, Martinussen J, Mollegaard NE, Douthwaite SR, Valentin-Hansen
P.

Department of Molecular Biology, Odense University, Denmark.

We have investigated the regulation of the Escherichia coli deoCp2 promoter by
the CytR repressor and the cyclic AMP (cAMP) receptor protein (CRP) complexed to
cAMP. Promoter regions controlled by these two proteins characteristically
contain tandem cAMP-CRP binding sites. Here we show that (i) CytR selectively
regulated cAMP-CRP-dependent initiations, although transcription started from
the same site in deoCp2 in the absence or presence of cAMP-CRP; (ii) deletion of
the uppermost cAMP-CRP target (CRP-2) resulted in loss of CytR regulation, but
had only a minor effect on positive control by the cAMP-CRP complex; (iii)
introduction of point mutations in either CRP target resulted in loss of CytR
regulation; and (iv) regulation by CytR of deletion mutants lacking CRP-2 could
be specifically reestablished by increasing the intracellular concentration of
CytR. These findings indicate that both CRP targets are required for efficient
CytR repression of deoCp2. Models for the action of CytR are discussed in light
of these findings.

PMID: 2170326 [PubMed - indexed for MEDLINE]

311: J Gen Microbiol. 1990 Sep;136(9):1825-31. 

Characterization of Escherichia coli adenylate cyclase mutants with modified
regulation.

Crasnier M, Danchin A.

Institut Pasteur, Unite de Regulation de l'Expression Genetique, Paris, France.

In Escherichia coli there is a large increase of cAMP synthesis in crp strains,
which are deficient in the catabolite gene activator protein. In this work it
was shown that this increase in cAMP synthesis does not occur in crp crr
strains, deficient in both the catabolite gene activator protein and
enzymeIII-glucose, a component of the phosphotransferase system. It was also
shown that the other components of the phosphotransferase system are required to
obtain the increase of cAMP synthesis in a crp background. Adenylate cyclase
mutants were obtained, by random mutagenesis, which had partial adenylate
cyclase activity but which did not exhibit increased levels of cAMP in a crp
background. For three mutants the mutation was identified as a single point
mutation. This allowed the identification of residues arginine 188, aspartic
acid 414 and glycine 463 which could be involved in the catabolite gene
activator protein dependent activation process.

PMID: 2178176 [PubMed - indexed for MEDLINE]

312: Cell. 1990 Aug 24;62(4):733-43. 

Stringent spacing requirements for transcription activation by CRP.

Gaston K, Bell A, Kolb A, Buc H, Busby S.

Unite de Physicochimie des Macromolecules Biologiques, URA 1149 du CNRS,
Institut Pasteur, Paris, France.

The cyclic AMP receptor protein-cAMP complex (CRP-cAMP) binds at a variety of
distances upstream of several E. coli promoters and activates transcription. We
have constructed a model system in which a consensus CRP binding site is placed
at different distances upstream of the melR promoter. CRP-cAMP activates
transcription from melR when bound at a number of positions, all of which lie on
the same face of the DNA helix. The two distances at which transcription is
strongly activated correspond exactly to those at which CRP-cAMP binds upstream
of the well-studied galP1 and lac promoters. Footprinting of the synthetic
promoters reveals that RNA polymerase makes identical contacts with their -10
regions even though CRP-cAMP binds at a different distance in each case. Kinetic
analysis in vitro indicates that CRP-cAMP activates transcription from these
promoters in similar but distinct ways. A model is proposed to explain this
two-position activation.

PMID: 2167178 [PubMed - indexed for MEDLINE]

313: FEMS Microbiol Rev. 1990 Aug;6(4):399-428. 

FNR and its role in oxygen-regulated gene expression in Escherichia coli.

Spiro S, Guest JR.

Department of Molecular Biology and Biotechnology, University of Sheffield, U.K.

Bacteria which can grow in different environments have developed regulatory
systems which allow them to exploit specific habitats to their best advantage.
In the facultative anaerobe Escherichia coli two transcriptional regulators
controlling independent networks of oxygen-regulated gene expression have been
identified. One is a two-component sensor-regulator system (ArcB-A), which
represses a wide variety of aerobic enzymes under anaerobic conditions. The
other is FNR, the transcriptional regulator which is essential for expressing
anaerobic respiratory processes. The purpose of this review is to summarize what
is known about FNR. The fnr gene was initially defined by the isolation of some
pleiotropic mutants which characteristically lacked the ability to use fumarate
and nitrate as reducible substrates for supporting anaerobic growth and several
other anaerobic respiratory functions. Its role as a transcriptional regulator
emerged from genetic and molecular studies in which its homology with CRP (the
cyclic AMP receptor protein which mediates catabolite repression) was
established and has since been particularly important in identifying the
structural basis of its regulatory specificities. FNR is a member of a growing
family of CRP-related regulatory proteins which have a DNA-binding domain based
on the helix-turn-helix structural motif, and a characteristic beta-roll that is
involved in nucleotide-binding in CRP. The FNR protein has been isolated in a
monomeric form (Mr 30,000) which exhibits a high but as yet non-specific
affinity for DNA. Nevertheless, the DNA-recognition site and important residues
conferring the functional specificity of FNR have been defined by site-directed
mutagenesis. A consensus for the sequences that are recognized by FNR in the
promoter regions of FNR-regulated genes, has likewise been identified. The basic
features of the genes and operons regulated by FNR are reviewed, and examples in
which FNR functions negatively as an anaerobic repressor as well as positively
as an anaerobic activator, are included. Less is known about the way in which
FNR senses anoxia and is thereby transformed into its 'active' form, but it
seems likely that cysteine residues and possibly a metal ion are involved. Four
of the five cysteine residues of FNR are clustered in an essential N-terminal
'domain' which is conserved in FNR and the HlyX protein of Actinobacillus
pleuropneumoniae, but not in CRP or the FixK protein of Rhizobium meliloti. The
relationships between FNR and other oxygen-related systems in E. coli are
discussed, as well as parallel systems in other organisms.(ABSTRACT TRUNCATED AT
400 WORDS)

Publication Types:
    Review

PMID: 2248796 [PubMed - indexed for MEDLINE]

314: Genetics. 1990 Aug;125(4):709-17. 

Analysis of sequence elements important for expression and regulation of the
adenylate cyclase gene (cya) of Salmonella typhimurium.

Thorner LK, Fandl JP, Artz SW.

Department of Microbiology, University of California, Davis 95616.

We determined the nucleotide sequence of the regulatory region of the cya gene
of Salmonella typhimurium. A set of nested BAL-31 deletions originating upstream
of the promoter/regulatory region and extending into the cya structural gene was
constructed in M13mp::cya phages and was tested for complementation of a
chromosomal cya deletion mutation. BAL-31 deletion mutants unable to complement
cya localized the major cya promoter. The synthetic tac promoter was inserted
upstream of the BAL-31 deletions so that expression of cya was dependent on
transcription from tac. Those tac derivative phages unable to complement cya
localized the translation initiation region. The cya DNA sequence revealed at
least three potential promoters capable of transcribing cya, with a CRP binding
site straddling the-10 hexamer of the promoter proximal to the structural gene.
The leader RNA sequence initiated at the latter promoter is approximately 140
bases long and includes a region that may form a stable secondary structure
(delta G = -23.8 kcal). There exist two possible in-frame translation start
points, one of which is TTG and the other of which is ATG. The sequence of the
S. typhimurium regulatory region was compared with that reported for Escherichia
coli.

PMID: 2204578 [PubMed - indexed for MEDLINE]

315: J Bacteriol. 1990 Jul;172(7):3813-20. 

Cloning and in vivo and in vitro regulation of cyclic AMP-dependent carbon
starvation genes from Escherichia coli.

Blum PH, Jovanovich SB, McCann MP, Schultz JE, Lesley SA, Burgess RR, Matin A.

Department of Microbiology and Immunology, Stanford University, California
94305-5402.

The regulation of three Escherichia coli carbon starvation (cst) genes fused to
lacZ was examined. Expression of these genes is induced by starvation for a
carbon source. The role of carbon and cyclic AMP (cAMP) availability and of an
altered-function crp mutation were investigated for their effect on cst
expression in vivo. The experiments indicated that cAMP concentrations
controlled the absolute expression of one cst fusion, but the other two cst
fusions were dependent upon some component not present in exponentially growing
cells under conditions of glucose excess, even when cAMP was added. To examine
the regulation of these genes in further detail, the three cst::lacZ fusions
were cloned on multicopy plasmids. All three cst::lacZ fusions retained their
inducible regulatory phenotype in the multicopy state. Analysis of the
expression of the cloned cst::lacZ fusions in an in vitro-coupled
transcription-translation cell-free system demonstrated that the predominant
promoter(s) present on each cloned DNA was dependent on sigma 70 for expression.
In vitro cAMP titration curves indicated that this molecule was necessary and
sufficient for the expression of one fusion but not sufficient for the second
fusion, while the third fusion exhibited constitutive levels of expression in
vitro. The results are discussed in the context of the E. coli carbon starvation
response.

PMID: 2163388 [PubMed - indexed for MEDLINE]

316: Mol Gen Genet. 1990 Jun;222(1):161-5. 

Transcription and regulation of the cpdB gene in Escherichia coli K12 and
Salmonella typhimurium LT2: evidence for modulation of constitutive promoters by
cyclic AMP-CRP complex.

Liu J, Beacham IR.

Division of Science and Technology, Griffith University, Brisbane, Qld.,
Australia.

Measurements of cyclic phosphodiesterase, or of beta-galactosidase in the case
of cpdB'-'lacZ fusions, indicate that cpdB expression in both Escherichia coli
and Salmonella typhimurium is modulated by carbon source availability,
consistent with previous observations in Salmonella. Nucleotide sequence
analysis and transcription mapping of both cpdB genes have revealed, in their 5'
flanking regions, sequences with good similarity to consensus -10 and -35
regions and cyclic AMP-cyclic AMP receptor protein (cAMP-CRP) binding sites.
Furthermore, they are strongly conserved in both organisms. Deletion analysis of
an E. coli cpdB'-'lacZ fusion supports the identification of these elements, and
a role for the cAMP-CRP binding site in modulating constitutive cyclic
phosphodiesterase expression.

PMID: 2172762 [PubMed - indexed for MEDLINE]

317: J Bacteriol. 1990 Jun;172(6):3529-33. 

Activation of expression of the Escherichia coli cir gene by an iron-independent
regulatory mechanism involving cyclic AMP-cyclic AMP receptor protein complex.

Griggs DW, Kafka K, Nau CD, Konisky J.

Department of Microbiology, University of Illinois, Urbana 61801.

Synthesis of the colicin I receptor protein, encoded by the cir gene, was
determined to be sensitive to control by the catabolite repression regulatory
system. Under both high- and low-iron conditions for growth, mutants unable to
produce cyclic AMP (cAMP) (cya) or functional cAMP receptor protein (crp)
exhibited decreased membrane levels of the receptor relative to those of the
wild-type strain. Exogenous addition of cAMP to the cya mutant restored maximal
expression. cAMP-dependent changes in steady-state levels of cir mRNA suggested
that the effect is mediated by control of transcript synthesis or stability.
Potential mechanisms for regulation were examined by deletion and sequence
analysis.

PMID: 2160948 [PubMed - indexed for MEDLINE]

318: J Bacteriol. 1990 May;172(5):2710-5. 

Transcriptional regulation of the heat shock regulatory gene rpoH in Escherichia
coli: involvement of a novel catabolite-sensitive promoter.

Nagai H, Yano R, Erickson JW, Yura T.

Institute for Virus Research, Kyoto University, Japan.

A catabolite-sensitive promoter was found to be involved in transcription of the
heat shock regulatory gene rpoH encoding the sigma 32 protein. Expression of
lacZ from the operon fusion, rpoHp-lacZ, was partially inhibited by glucose
added to the broth medium. Dissection of the rpoH promoter region allowed us to
localize the glucose-sensitive promoter to the 110-base-pair (bp) segment
directly upstream of the rpoH coding region. Experiments on lacZ expression from
the set of fusions in cya (adenylate cyclase) and crp (cyclic AMP [cAMP]
receptor protein) mutants also supported the involvement of a
catabolite-sensitive promoter. Analysis of rpoH mRNAs by S1 nuclease protection
experiments led us to identify a novel promoter, designated P5, that is
regulated by cAMP and the cAMP receptor protein. Studies of rpoH transcription
in vitro demonstrated that RNA polymerase-sigma 70 can transcribe from the P5
promoter only in the presence of cAMP and its receptor protein. The 5' ends of
P5 transcripts obtained in vivo and in vitro were found to be at 61 to 62 bp
upstream of the initiation codon, and a putative binding sequence for the cAMP
receptor protein was found at 38 to 39 bp further upstream. Transcription from
the P5 promoter is increased by the addition of ethanol to the growth medium;
however, the increase is greater in the presence of glucose than in its absence.
These results add a new dimension to the transcriptional control of rpoH and to
the regulation of the heat shock response in Escherichia coli.

PMID: 2139650 [PubMed - indexed for MEDLINE]

319: J Biolumin Chemilumin. 1990 Apr-Jun;5(2):99-106. 

Control of the lux regulon of Vibrio fischeri.

Shadel GS, Devine JH, Baldwin TO.

Department of Biochemistry and Biophysics, Texas A & M University, College
Station 77843.

Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon
in Escherichia coli is a consequence of a unique form of positive feedback
superimposed on a poorly defined cis-acting repression mechanism. The lux
regulon consists of two divergently transcribed operons. The leftward operon
contains only a single gene, luxR, which encodes a transcriptional activator
protein. The rightward operon contains luxI, which together with luxR and the
218 base pairs separating the two operons comprises the primary regulatory
circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which
are required for the bioluminescence activity. Transcription of luxR from PL is
stimulated by binding of the E. coli crp gene product to the sequence
TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP
protein in a cAMP-dependent reaction to the V. fischeri lux regulatory region
has been demonstrated by in vitro footprinting. The luxI gene product is an
enzyme which catalyses a condensation reaction of cytoplasmic substrates to
yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of
autoinducer, which is freely diffusible, results in formation of a complex with
LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to
stimulate transcription of the rightward operon. Increased transcription from PR
should yield increased levels of LuxI and higher levels of autoinducer which
would further activate LuxR. The LuxR binding site is also a LexA binding site,
as demonstrated by in vitro footprinting. Basal transcription from both PL and
PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED
AT 250 WORDS)

PMID: 2186599 [PubMed - indexed for MEDLINE]

320: FEMS Microbiol Lett. 1990 Mar 15;56(3):307-11. 

Cyclic AMP stimulates transcription of the structural gene of the outer-membrane
protein OmpA of Escherichia coli.

Gibert I, Barbe J.

Department of Genetics and Microbiology, Faculty of Sciences, Autonomous
University of Barcelona, Bellaterra, Spain.

To analyze the effect of cyclic AMP on the expression of the ompA gene of
Escherichia coli, encoding the outer-membrane protein OmpA, a fusion between
this gene and the lacZ gene was constructed in vitro by using a promoter-probe
plasmid. The results obtained indicated that the presence of glucose in the
culture medium decreased the transcription of the ompA gene. Likewise, cya and
crp mutants exhibited lower levels of ompA gene expression than the wild-type
strain. Furthermore, the addition of cyclic AMP increased the expression of the
ompA gene in both cya and wild-type strains but not in a crp mutant. All these
data show that the cyclic AMP receptor protein-cyclic AMP complex positively
modulates ompA transcription in E. coli K-12.

PMID: 2160397 [PubMed - indexed for MEDLINE]

321: Genetika. 1990 Mar;26(3):433-42. 

[The effect of specific mutation crp a in the genetic locus of receptor protein
cAMP (CRP) on the expression of Escherichia coli K-12 deo-operon]

[Article in Russian]

Nechaeva GD, Mironov AS.

Expression of the deo operon of Escherichia coli is subjected to double negative
control by DeoR and CytR repressors and to the positive control by cAMP-CRP
complex. However, sensitivity of the deo operon to catabolite repression is only
revealed in bacteria with disrupted synthesis of the CytR protein, since the
function of the latter is to prevent CRP activation of the deo operon
transcription. In the present work we have studied the influence of crpa
specific mutation at the genetic locus of CRP protein on the expression of the
deo operon of E. coli. It has been found that the presence of crpa mutation in
bacterial genome completely eliminates CytR repression of the deo operon, so
that activation of Deo enzymes synthesis by cAMP-CRPa complex becomes possible,
even in the presence of CytR. Besides, the modified CRPa protein appears to
block the activity of catabolite-sensitive deoPO2 promoter of the deo operon
under conditions of cAMP deficiency, which is manifested in the two-fold
decrease of deoR derepression in the crpa cells, as compared to the wild type
bacteria during the growth on glucose containing medium. It has been supposed
that both effects are due to increased affinity of the modified CRPa protein to
the specific sites of catabolite sensitive promoters, as compared to the wild
type CRP protein.

PMID: 2191896 [PubMed - indexed for MEDLINE]

322: Mol Gen Mikrobiol Virusol. 1990 Mar;(3):18-21. 

[Study of the regulation of crp gene expression in Escherichia coli K12]

[Article in Russian]

Lisenkov AF, Smirnov IuV.

The regulation of crp gene expression by CRP-cAMP complex was studied in E. coli
strain by the crp-lac operon fusion. F'141 crp+ episome decreased 5-7 fold the
high level of crp-lac expression in crp strains while F'141 crp episome had no
effect. The hybrid plasmid pCAP2 crp+ with the intact crp gene did not affect
the crp gene expression level in crp mutants, though they had acquired the Crp+
phenotype just as they did in F'141 crp+ presence. The F'141 crp+ and pCAP2 crp+
combination in crp mutants also resulted in decrease of the crp gene expression
comparable to the registered in the presence of the F'141 crp+ plasmid. Similar
repression occurred only in cya+ strains but not in cya strains. The crp gene is
supposed to possess negative regulation by CRP-cAMP complex with a complementary
factor also necessary. The latter is evidently located in an E. coli chromosome
site overlapped by F'141 episome.

PMID: 2163492 [PubMed - indexed for MEDLINE]

323: Genet Res. 1990 Feb;55(1):1-6. 

A cya deletion mutant of Escherichia coli develops thermotolerance but does not
exhibit a heat-shock response.

Delaney JM.

Department of Microbiology and Immunology, College of Medicine, University of
Arizona, Tucson 85724.

An adenyl cyclase deletion mutant (cya) of E. coli failed to exhibit a
heat-shock response even after 30 min at 42 degrees C. Under these conditions,
heat-shock protein synthesis was induced by 10 min in the wild-type strain.
These results suggest that synthesis of heat-shock proteins in E. coli requires
the cya gene. This hypothesis is supported by the finding that a presumptive
cyclic AMP receptor protein (CRP) binding site exists within the promoter region
of the E. coli htpR gene. In spite of the absence of heat-shock protein
synthesis, when treated at 50 degrees C, the cya mutant is relatively more heat
resistant than wild type. Furthermore, when heat shocked at 42 degrees C prior
to exposure at 50 degrees C, the cya mutant developed thermotolerance. These
results suggest that heat-shock protein synthesis is not essential for
development of thermotolerance in E. coli.

PMID: 2180785 [PubMed - indexed for MEDLINE]

324: Gene. 1989 Dec 21;85(1):125-34. 

Nucleotide sequences of the Erwinia chrysanthemi ogl and pelE genes negatively
regulated by the kdgR gene product.

Reverchon S, Huang Y, Bourson C, Robert-Baudouy J.

Laboratoire de Genetique Moleculaire des Microorganismes, Institut National des
Sciences Appliquees, Villeurbanne, France.

The nucleotide sequences of the coding and regulatory regions of the genes
encoding oligoglacturonate lyase (OGL) and pectate lyase e isoenzyme (PLe) from
Erwinia chrysanthemi 3937 were determined. The ogl sequence contains an open
reading frame (ORF) of 1164 bp coding for a 388-amino acid (aa) polypeptide with
a predicted Mr of 44,124. A possible transcriptional start signal showing
homology with the Escherichia coli promoter consensus sequence was detected. In
addition, a sequence 3' to the coding region was found to be able to form a
secondary structure which may function as an Rho-independent transcriptional
termination signal. For the pelE sequence, a long ORF of 1212 bp coding for a
404-aa polypeptide was detected. PLe is secreted into the external medium by E.
chrysanthemi, and a potential signal peptide sequence was identified in the pelE
gene. In the 5' upstream pelE coding region, a putative promoter resembling E.
coli promoter consensus sequences was detected. Furthermore, the region
immediately 3' to the pelE translational stop codon may function as an
Rho-independent translational termination signal. In strain 3937, the synthesis
of OGL and PLe, as well as the other enzymes involved in the pectin-degradative
pathway (particularly the kdgT product), are known to be regulated by the KdgR
repressor, which mediates galacturonate and polygalacturonate induction.
Synthesis of these enzymes is also regulated by the CRP-cAMP complex which
mediates catabolite repression. Analysis of the regulatory regions of ogl and
pelE allowed us to identify possible CRP-binding sites for these two
genes.(ABSTRACT TRUNCATED AT 250 WORDS)

PMID: 2695393 [PubMed - indexed for MEDLINE]

325: J Bacteriol. 1989 Nov;171(11):5995-6004. 

Characterization of the oxygen-dependent promoter of the Vitreoscilla hemoglobin
gene in Escherichia coli.

Khosla C, Bailey JE.

Division of Chemistry and Chemical Engineering, California Institute of
Technology, Pasadena 91125.

The gene coding for the Vitreoscilla hemoglobin (VHb) molecule has been cloned
and functionally expressed in Escherichia coli. By using a plasmid-encoded gene
as well as single-copy integrants, the oxygen-dependent VHb gene (VHb) promoter
was shown to be functional in E. coli. The promoter was maximally induced under
microaerobic conditions (dissolved oxygen levels of less than 2% air
saturation). Direct analysis of mRNA levels as well as the use of gene fusions
with lacZ showed that oxygen-dependent regulation occurred at the level of
transcription. Transcriptional activity decreased substantially under anaerobic
conditions, suggesting the presence of a regulatory mechanism that is maximally
induced under hypoxic but not completely anaerobic conditions in E. coli. Primer
extension analysis was used to identify the existence of two overlapping
promoters within a 150-base-pair region upstream of the structural VHb gene. The
oxygen-dependent activity of both promoters was qualitatively similar,
suggesting the existence of a common mechanism by which available oxygen
concentrations influence expression from the two promoters. Analysis of promoter
activity in crp and cya mutants showed that both cyclic AMP and catabolite
activator protein were required for full activity of the promoter. The VHb
promoter contained a region of significant homology to the catabolite activator
protein-binding site near the E. coli lac promoter.

PMID: 2681149 [PubMed - indexed for MEDLINE]

326: Mol Microbiol. 1989 Nov;3(11):1557-65. 

Upstream activating sequences that are shared by two divergently transcribed
operons mediate cAMP-CRP regulation of pilus-adhesin in Escherichia coli.

Goransson M, Forsman P, Nilsson P, Uhlin BE.

Department of Microbiology, University of Umea, Sweden.

Transcription of the genes encoding pilus-adhesin of serotype F13 in
digalactoside-binding Escherichia coli required activation by the cAMP-CRP
complex. Analysis of protein-DNA interaction in vitro showed that CRP bound in a
cAMP-dependent manner to a sequence located 0.2 kb upstream of the point of
transcription initiation of the pilus subunit operon. The cAMP-CRP activation
included, in addition to the main pilus operon, the oppositely oriented operon
encoding the Papl regulatory protein. Furthermore, the auto-regulatory product
of the promoter-proximal gene (papB) in the pilus subunit operon was found to
stimulate the papl transcriptional unit. Thus the cAMP-CRP complex and PapB
might act in concert and indirectly promote pili synthesis by stimulating
expression of the Papl positive regulator. The results of trans-complementation
experiments and analyses using lacZ operon fusion derivatives showed that the
cAMP-CRP activation also operated directly in cis on the pilus subunit operon.
The region containing the CRP binding site appeared to function as an upstream
activating sequence since deletion abolished expression even when the pap
regulatory proteins Papl and PapB were supplied in trans. The implications for
possible mechanisms of transcriptional activation by the cAMP-CRP complex at
this novel location between the two oppositely oriented operons are discussed.

PMID: 2575704 [PubMed - indexed for MEDLINE]

327: Mol Microbiol. 1989 Oct;3(10):1385-90. 

CRP/cAMP- and CytR-regulated promoters in Escherichia coli K12: the cdd
promoter.

Valentin-Hansen P, Holst B, Josephsen J, Hammer K, Albrechtsen B.

Department of Molecular Biology, University of Odense, Denmark.

Transcriptional regulation of the deoP2 promoter by the cyclic AMP/cyclic AMP
receptor protein complex (cAMP/CRP) and the CytR repressor requires two
high-affinity CRP targets located around -41 and -93 bp preceding the start site
for transcription. Here we report the structure of cddP, another
CRP/CytR-regulated promoter. In common with what was found in deo, the cdd
promoter also contains multiple CRP targets. Thus, using the DNasel footprinting
procedure, tandem CRP binding sites were identified around -41 and -93. These
findings support a general model for CytR binding and CytR regulation, in which
(i) CytR and the CRP/cAMP complex bind to similar or identical targets, (ii) two
or more targets are necessary for proper binding of CytR to a promoter region,
and (iii) CytR represses transcription by antagonizing cAMP/CRP activation.

PMID: 2575702 [PubMed - indexed for MEDLINE]

328: J Mol Biol. 1989 Jun 20;207(4):661-73. 

Activation of the lac promoter and its variants. Synergistic effects of
catabolite activator protein and supercoiling in vitro.

Meiklejohn AL, Gralla JD.

Department of Chemistry and Biochemistry, University of California, Los Angeles
90024.

Escherichia coli lac promoter variants are shown to be subject to large
synergistic transcriptional activation by catabolite activator protein (CRP) and
DNA supercoiling in vitro. Activation was studied for the lac wild-type
promoter, a promoter with a variant spacing (lac delta l) and two promoters with
variant -10 regions (lac ps, lac UV5). The variant promoters respond to the
simultaneous presence of CRP and supercoiling by exhibiting large multiplicative
activation at the low to moderate superhelicities that are most pertinent in
vivo. Although all four promoters can be activated by CRP, those made stronger
by changing downstream promoter elements are less CRP-activated even though each
contains an identical CRP binding site. When each of the variant promoters is
made stronger by introducing DNA supercoils, the apparent CRP activation
initially remains constant but eventually declines at higher superhelicities.
Thus, strengthening the lac promoter through either DNA sequence changes or the
introduction of high-level DNA supercoiling can lead to diminished potential for
activation by CRP. These results are interpreted in terms of a role for CRP in
providing extra stabilizing contacts for RNA polymerase binding that are
necessary only when other stabilizing features of promoter structure are
lacking.

PMID: 2547970 [PubMed - indexed for MEDLINE]

329: Wei Sheng Wu Xue Bao. 1989 Jun;29(3):180-6. 

[Regulation in the expression of alpha-galactosidase gene in raf operon in
Escherichia coli]

[Article in Chinese]

Su TZ, Qi S, Yun WH, Xiu L.

The alpha-galactosidase, coded for by the first structural gene rafA in the
plasmid determined raf operon was an inducible enzyme. In contrast to lac or mel
operon, raf operon has more strict structural specificity for inducers. The
enzyme can be induced by melibiose and raffinose, or weakly by D-galactose, but
not by structurally related sugars such as lactose, PNPG etc.. The
alpha-galactosidase forming capacity as function of growth curve reached a
single peak at the end of the logarithmic phase of the growth. The structure and
regulation of raf operon is similar to those of lac operon. The
repressormor-mediated negative control plays a major role in the regulation of
raf operon, and cAMP-CAP mediated positive control is also involved in the
regulation. When 0.4% glucose was added into the medium with other carbon
sources, the expression of the enzyme was repressed by 2-3 fold. Transient
catabolite repression has been observed neither in inducible nor constitutive
alpha-galactosidase expression. Based on alpha-galactosidase assay, in mutant
strains CA8306(cya) and CA8445 (cya, crp) the expression level of raf operon was
only 9% and 2.5% of that in wild type strain respectively. The glucose effect or
the repression in cya mutant can be abolished by 1-5 mmol cAMP. The constitutive
alpha-galactosidase expression in cya and cry double mutant (CA8445) remains
repressible by glucose, but irreversible by cAMP, suggesting cAMP-CAP complex is
not the exclusive mediator of the catablite repression.(ABSTRACT TRUNCATED AT
250 WORDS)

PMID: 2551100 [PubMed - indexed for MEDLINE]

330: J Bacteriol. 1989 May;171(5):2909-12. 

Control mechanism of the Escherichia coli K-12 cell cycle is triggered by the
cyclic AMP-cyclic AMP receptor protein complex.

Utsumi R, Noda M, Kawamukai M, Komano T.

Department of Agricultural Chemistry, Kinki University, Higashiosaka, Japan.

The role of cyclic AMP (cAMP) in the cell cycle of Escherichia coli K-12 was
studied in three mutant strains. One was KI1812, in which the cya promoter is
replaced by the lacUV5 promoter. In KI1812,
isopropyl-beta-D-thiogalactopyranoside induced the synthesis of cya mRNA, and at
the same time cell division was inhibited and short filaments containing
multiple nuclei were formed. The other strains were constructed as double
mutants (NC6707 cya sulB [ftsZ(Ts)] and TR3318 crp sulB [ftsZ(Ts)]). In both
double mutants, filamentation was repressed at 42 degrees C, but it was induced
again by addition of cAMP in strain NC6707 and introduction of pHA7 containing
wild-type crp in TR3318. These results indicate that lateral wall synthesis in
the E. coli cell cycle is triggered by the cAMP-cAMP receptor protein complex.

PMID: 2540158 [PubMed - indexed for MEDLINE]

331: J Bacteriol. 1989 May;171(5):2773-82. 

Genetic regulation of glycogen biosynthesis in Escherichia coli: in vitro
effects of cyclic AMP and guanosine 5'-diphosphate 3'-diphosphate and analysis
of in vivo transcripts.

Romeo T, Preiss J.

Department of Biochemistry, Michigan State University, East Lansing 48824.

Glycogen accumulation in Escherichia coli is inversely related to the growth
rate and occurs most actively when cells enter the stationary phase. The levels
of the three biosynthetic enzymes undergo corresponding changes under these
conditions, suggesting that genetic control of enzyme biosynthesis may account
for at least part of the regulation (J. Preiss, Annu. Rev. Microbiol.
38:419-458, 1984). We have begun to explore the molecular basis of this control
by identifying factors which affect the expression of the glycogen genes and by
determining the 5'-flanking regions required to mediate the regulatory effects.
The in vitro coupled transcription-translation of two of the biosynthetic genes,
glgC (ADPglucose pyrophosphorylase) and glgA (glycogen synthase), was enhanced
up to 26- and 10-fold, respectively, by cyclic AMP (cAMP) and cAMP receptor
protein (CRP). Guanosine 5'-diphosphate 3'-diphosphate stimulated the expression
of these genes 3.6- and 1.8-fold, respectively. The expression of glgB (glycogen
branching enzyme) was affected weakly or negligibly by the above-mentioned
compounds. Assays which measured the in vitro formation of the first dipeptide
of glgC showed that a restriction fragment which contained 0.5 kilobases of DNA
upstream from the initiation codon supported cAMP-CRP-activated expression.
Sequence-specific binding of cAMP-CRP to a 243-base-pair restriction fragment
from the region upstream from glgC was observed by virtue of the altered
electrophoretic mobility of the bound DNA. S1 nuclease protection analysis
identified 5' termini of four in vivo transcripts within 0.5 kilobases of the
glgC coding region. The relative concentrations of transcripts were higher in
the early stationary phase than in the exponential phase. Two mutants which
overproduced the biosynthesis enzymes accumulated elevated levels of specific
transcripts. The 5' termini of three of the transcripts were mapped to a high
resolution. Their upstream sequences showed weak similarity to the E. coli
consensus promoter. These results suggest complex transcriptional regulation of
the glycogen biosynthesis genes involving multiple promoter sites and direct
control of gene expression by at least two global regulatory systems.

PMID: 2468650 [PubMed - indexed for MEDLINE]

332: EMBO J. 1989 Apr;8(4):1279-86. 

fixK, a gene homologous with fnr and crp from Escherichia coli, regulates
nitrogen fixation genes both positively and negatively in Rhizobium meliloti.

Batut J, Daveran-Mingot ML, David M, Jacobs J, Garnerone AM, Kahn D.

Laboratoire de Biologie Moleculaire des Relations Plantes-Microorganismes,
CNRS-INRA, Castanet-Tolosan, France.

Nitrogen fixation genes are shown to undergo a complex positive and negative
regulation in Rhizobium meliloti. Activation of fixN by fixLJ is shown to
require a third regulatory gene, fixK. As fixK is activated by fixLJ, we propose
a cascade model for fixN regulation such that fixLJ activates fixN via fixK. In
addition fixK negatively regulates expression of the nif-specific activator nifA
as well as its own expression by autoregulation. Thus nifA and fixK are subject
to a mixed regulation, positive (by fixLJ) and negative (by fixK). The sequence
of fixK shows homology with the Escherichia coli regulators fnr and crp, which
makes fixK the third characterized member of this family of prokaryotic
regulators.

PMID: 2663474 [PubMed - indexed for MEDLINE]

333: EMBO J. 1989 Apr;8(4):1247-55. 

RNA polymerase and gal repressor bind simultaneously and with DNA bending to the
control region of the Escherichia coli galactose operon.

Kuhnke G, Theres C, Fritz HJ, Ehring R.

Institut fur Genetik, Universitat zu Koln, FRG.

The Escherichia coli galactose operon contains an unusual array of closely
spaced binding sites for proteins governing the expression from the two
physically overlapping gal promoters. Based on studies of two gal promoter-up
mutants we have previously suggested RNA-polymerase-induced DNA bending of gal
promoter DNA. Here we present new evidence confirming and extending this
interpretation. It was obtained by the circular permutation assay of gel
electrophoretic mobility [Wu and Crothers (1984), Nature, 308, 509-513] applied
to three analogous series of circularly permuted fragments derived from
wild-type and two promoter-up mutant DNAs. The same circularly permuted DNA
fragments have further been used to study the binding of gal repressor to its
operator sites by electrophoretic mobility shift and by DNase I footprinting
techniques. The main results are: (i) complexes carrying repressor either
exclusively at the upstream operator O1 or at the downstream operator O2 exhibit
different electrophoretic mobilities; (ii) binding to either one of the
operators results in protein-induced DNA bending by the criteria of the circular
permutation mobility assay; and (iii) occupation of both gal operators by gal
repressor does not prevent cAMP-CRP-independent binding of RNA polymerase to the
gal promoters, as judged by DNase I protection and gel retardation assays. The
latter finding imposes constraints on any attempt to model the regulation of gal
expression by assumed DNA-protein and protein-protein interactions.

PMID: 2663472 [PubMed - indexed for MEDLINE]

334: Genetika. 1989 Mar;25(3):438-47. 

[Interaction of negative (CytT) and positive (cAMP-CRP) regulation in the
promoter region of the uridine phosphorylase (udp) gene in Escherichia coli
K-12]

[Article in Russian]

Mironov AS, Nechaeva GD, Sukhodolets VV.

Interaction of negative (CytR) and positive (cAMP-CRP) control in the promoter
region of the uridine phosphorylase (udp) gene of Escherichia coli has been
studied by using udp-lac operon fusions in which the structural lacZ gene is
expressed from the wild type promoter udpP+ or from mutant promoters udpP1 and
udpP18. The specific activity of beta-galactosidase was examined in these
fusions in cytR+ and cytR- backgrounds after introduction of specific mutations
in crp locus, crp* and crp(a) altering interaction of CRP protein with
catabolite-sensitive promoters. The data obtained using crp* mutation confirm
the proposed model of the udp gene regulation, according to which CytR repressor
protein interferes with CRP binding site in the promoter-operator region of the
udp gene and thereby prevents the positive action of cAMP-CRP complex on the udp
expression. Additional data in favor of this model were obtained using crp(a)
mutation which most probably alters the structure of CRP protein in such a way
that it exhibits more high affinity to the udp promoter, as compared to the CytR
repressor protein. Indeed, taken by itself, the crp(a) mutation did not lead to
any increase in the expression of udpP+-lac fusion under the conditions of cAMP
limitation (on glucose-grown cells), in spite of whether or not the CytR
repressor was present. However, when combined with the ptsG mutation or when
cells were grown on succinate medium, complete constitutive expression of
udpP+-lac fusion is observed, even in the presence of the cytR gene product. The
effect of the crp(a) mutation was virtually the same in strains harboring
udpP1-lac fusion. These data are in accordance with suggestion that udpP1 is a
mutation in the site of the promoter-operator region that responds to the cytR
gene product, while the corresponding binding site for CRP protein is still
unaltered in this mutant. On the other hand, the crp(a) mutation causes only
slight alteration in the expression of udpP18-lac fusion, providing additional
evidence that udpP18 mutation seems to comprise a modification of the
promoter-operator region, where binding sites for CRP and CytR proteins overlap.

PMID: 2668121 [PubMed - indexed for MEDLINE]

335: Mol Gen Genet. 1989 Feb;215(3):537-42. 

Interaction of the CRP-cAMP complex with the cea regulatory region.

Salles B, Weinstock GM.

Department of Biochemistry and Molecular Biology, University of Texas Medical
School, Houston 77225.

Analysis of the induction of expression of cea-lacZ fusions in cya and crp
mutants showed that catabolite repression affects the kinetics of induction and
the rate of induced synthesis. In a cya mutant, addition of cAMP reduced the
induction lag and increased the amount of beta-galactosidase produced. The
CRP-cAMP complex was found to bind to two sites 5' to the cea promoter, but
deletion analysis showed that only one of these was involved in the control of
cea. Deletion of this site resulted in a loss of the stimulatory effects of cAMP
in a cya mutant.

PMID: 2540417 [PubMed - indexed for MEDLINE]

336: Arch Microbiol. 1989;151(5):466-8. 

Regulation of lysine decarboxylase activity in Escherichia coli K-12.

Auger EA, Bennett GN.

Department of Biochemistry, Rice University, Houston, TX 77251.

The biodegradative lysine decarboxylase of E. coli has been reported to attain a
higher specific activity when grown to saturation in the presence of excess
lysine under conditions of low pH and absence of aeration. In order to examine
possible sources of the pH and anaerobic regulation, a series of isogenic
strains of E. coli K-12 were constructed. The effects of cadR-, fnr-, cya-, crp-
and pgi- mutations on lysine decarboxylase expression were examined. Cultures
were grown in a lysine supplemented rich medium at pH 5.5, pH 6.8, and pH 8.0
with and without aeration and the enzyme was assayed from log phase cultures.
The results suggested that the pH and air responses were independent and that
these known regulatory processes are not responsible for this regulation of the
biodegradative lysine decarboxylase.

PMID: 2662934 [PubMed - indexed for MEDLINE]

337: Mol Gen Mikrobiol Virusol. 1988 Dec;(12):23-8. 

[Study of the expression of the cya gene in Escherichia coli K12 on a model of
the hybrid cya-lac operon]

[Article in Russian]

Lisenkov AF, Smirnov IuV.

Bacteriophage Mud1 (Ap, lac) was used to construct the cya-lac operon fusion in
Escherichia coli chromosome. The maximal cya expression was observed by
measuring the levels of beta-galactosidase in the strains lacking the cAMP. The
inhibition of cya transcription was proportional either to the amount of cAMP
added or to the copy number of cya gene in the cell. Functional cAMP receptor
protein (CRP) was necessary for the effect. The cya gene expression was low in
cAMP-independent crp mutant even in the absence of the cAMP.

PMID: 2855091 [PubMed - indexed for MEDLINE]

338: J Bacteriol. 1988 Nov;170(11):5076-9. 

Evidence in vivo for autogenous control of the cyclic AMP receptor protein gene
(crp) in Escherichia coli by divergent RNA.

Okamoto K, Hara S, Bhasin R, Freundlich M.

Department of Microbiology, Fujita-Gakuen University, Aichi, Japan.

Control of crp expression in vivo was studied by using the cloned crp gene. The
synthesis of the product of this gene, cyclic AMP (cAMP) receptor protein (CRP),
was strongly reduced by exogenous cAMP. This regulation was completely abolished
by the inactivation of a divergent promoter located within the crp promoter
region. These data are consistent with our in vitro studies (Okamoto and
Freundlich, Proc.Natl. Acad. Sci. USA 83:5000-5004, 1986), which showed that crp
autoregulation is due to the inhibition of crp transcription by divergent
(antisense) RNA produced by cAMP-CRP activation of the divergent promoter.

PMID: 3053643 [PubMed - indexed for MEDLINE]

339: J Mol Biol. 1988 Oct 5;203(3):569-83. 

Positive and negative regulators for glucitol (gut) operon expression in
Escherichia coli.

Yamada M, Saier MH Jr.

Department of Biology, John Muir College, University of California at San Diego,
La Jolla 92093.

Expression of the glucitol (gut) operon in Escherichia coli is regulated by an
unusual, complex system which consists of an activator (encoded by the gutM
gene) and a repressor (encoded by the gutR gene) in addition to the cAMP-CRP
complex (CRP, cAMP receptor protein). The activator and repressor are predicted
to possess 119 (Mr = 12,955) and 257 (Mr = 28,240) aminoacyl residues,
respectively, as deduced from the nucleotide sequences of their structural
genes. Both of the genes encoding the two regulators are located downstream from
the other known gut structural genes. Reverse transcriptase mapping revealed
that the gutM gene is a promoter-distal constituent of the gut operon. The gutR
gene has its own promoter, but expression of this gene is primarily due to
readthrough from the gut operon operator-promoter. Thus, the gut operon consists
of at least five structural genes and has the following gene order: gutOPABDMR.
Interestingly, synthesis of the mRNA, which initiates at the promoter specific
to the gutR gene, occurs within the gutM gene. Expressional control of the gut
operon appears to occur as a consequence of the antagonistic action of the
products of the autogenously regulated gutM and gutR genes. An additional
cistron of the gut operon, of unknown function, may follow the gutR gene.

PMID: 3062173 [PubMed - indexed for MEDLINE]

340: J Bacteriol. 1988 Sep;170(9):4040-6. 

Control of Vibrio fischeri lux gene transcription by a cyclic AMP receptor
protein-luxR protein regulatory circuit.

Dunlap PV, Greenberg EP.

Department of Biology, New Mexico State University, Las Cruces 88003.

Expression of the Vibrio fischeri luminescence genes (lux genes) requires two
transcriptional activators: the V. fischeri luxR gene product with autoinducer
and the cyclic AMP (cAMP) receptor protein (CRP) with cAMP. It has been
established that autoinducer and the luxR gene product are required for
transcriptional activation of the luxICDABE operon, which contains a gene
required for autoinducer synthesis and genes required for light emission.
However, the role of cAMP-CRP in the induction of luminescence is not clear. We
examined transcriptional control of the lux genes in Escherichia coli, using
catabolite repression mutants carrying lux DNA-containing plasmids.
Transcriptional fusions between the lacZ gene on Mu dI and luxR were used to
assess luxR promoter activity, and the luxAB genes (which encode the two
luciferase subunits) were used as a natural reporter of luxICDABE promoter
activity. A plasmid containing luxR under control of the cAMP-CRP-independent
tac promoter was constructed to direct the synthesis of the luxR gene product in
cells containing compatible luxR::Mu dI insertion mutant plasmids. In E. coli,
cAMP-CRP activated transcription of luxR and concurrently decreased luxICDABE
transcription. In the presence of relatively high levels of the luxR gene
product, cAMP and CRP were not required for induction of the luxICDABE operon.
The luxR gene product in the presence of autoinducer activated transcription of
the luxICDABE operon, as has been shown previously, and we demonstrate that it
also decreased luxR transcription. Apparently, control of the V. fischeri
luminescence genes involves a regulatory circuit in which cAMP and CRP activate
luxR transcription and in turn the luxR gene product activates transcription of
the operon responsible for light emission (uxICDABE). Furthermore, in lux gene
regulation cAMP-CRP and autoinducer-LuxR protein appear to function as
transcriptional antagonists.

PMID: 3410823 [PubMed - indexed for MEDLINE]

341: J Bacteriol. 1988 Sep;170(9):3903-9. 

Differential regulation by cyclic AMP of starvation protein synthesis in
Escherichia coli.

Schultz JE, Latter GI, Matin A.

Department of Microbiology and Immunology, Stanford University School of
Medicine, California 94305-5402.

Of the 30 carbon starvation proteins whose induction has been previously shown
to be important for starvation survival of Escherichia coli, two-thirds were not
induced in cya or crp deletion mutants of E. coli at the onset of carbon
starvation. The rest were induced, although not necessarily with the same
temporal pattern as exhibited in the wild type. The starvation proteins that
were homologous to previously identified heat shock proteins belonged to the
latter class and were hyperinduced in delta cya or delta crp mutants during
starvation. Most of the cyclic AMP-dependent proteins were synthesized in the
delta cya mutant if exogenous cyclic AMP was added at the onset of starvation.
Furthermore, beta-galactosidase induction of several carbon starvation response
gene fusions occurred only in a cya+ genetic background. Thus, two-thirds of the
carbon starvation proteins of E. coli require cyclic AMP and its receptor
protein for induction; the rest do not. The former class evidently has no role
in starvation survival, since delta cya or delta crp mutants of either E. coli
or Salmonella typhimurium survived starvation as well as their wild-type parents
did. The latter class, therefore, is likely to have a direct role in starvation
survival. This possibility is strengthened by the finding that nearly all of the
cya- and crp-independent proteins were also induced during nitrogen starvation
and, as shown previously, during phosphate starvation. Proteins whose synthesis
is independent of cya- and crp control are referred to as Pex (postexponential).

PMID: 2842291 [PubMed - indexed for MEDLINE]

342: Nucleic Acids Res. 1988 Aug 11;16(15):7315-32. 

Regulatory effect of a synthetic CRP recognition sequence placed downstream of a
promoter.

Morita T, Shigesada K, Kimizuka F, Aiba H.

Department of Chemistry, University of Tsukuba, Japan.

A series of plasmids were constructed in which a promoter was introduced into a
lac-based operon fusion vector. A perfectly symmetrical oligonucleotide of 22-bp
corresponding to an idealized binding site for cAMP receptor protein (CRP) of E.
coli was chemically synthesized. The synthetic CRP site was placed between the
promoter and the lacZ structural gene with varying distances from the promoter.
Specific binding of cAMP-CRP complex to the synthetic CRP site was shown by a
gel retardation and a DNase I footprinting assays. Plasmid constructs were
transformed into crp+ and crp- cells carrying a chromosomal deletion of the lac
genes. The regulatory effect of the inserted CRP site was examined by comparing
the beta-galactosidase activity and the levels of RNA transcript in two cells
harboring the plasmids. We found a strong inhibitory effect of the CRP site in
the presence of cAMP and CRP when it was placed close to the promoter. When the
CRP site was placed far downstream of the promoter, a moderate repression of
transcription was observed.

PMID: 2842730 [PubMed - indexed for MEDLINE]

343: Mol Microbiol. 1988 Jul;2(4):527-30. 

The nirB promoter of Escherichia coli: location of nucleotide sequences
essential for regulation by oxygen, the FNR protein and nitrite.

Jayaraman PS, Gaston KL, Cole JA, Busby SJ.

Department of Biochemistry, University of Birmingham, UK.

Using recombinant DNA techniques, nested deletions have been made upstream of
the Escherichia coli nirB transcription start site and their effects on the
regulation of nirB promoter activity have been measured. Nucleotide sequences
downstream of -73 are sufficient for FNR-dependent induction of activity by
anaerobic growth conditions. However, nucleotide sequences between -87 and -149
are essential for further induction by nitrite in the growth medium. The
nucleotide sequence at the galP1 CRP binding site located from -31 to -52
displays some similarities with the same region at the nirB promoter. When the
galP1 sequence from -30 to -54 was replaced by the corresponding nirB sequence,
expression from galP1 became inducible by FNR under anaerobic growth conditions.

PMID: 2845227 [PubMed - indexed for MEDLINE]

344: J Bacteriol. 1988 Jul;170(7):3110-4. 

Cyclic AMP-cyclic AMP receptor protein as a repressor of transcription of the
spf gene of Escherichia coli.

Polayes DA, Rice PW, Garner MM, Dahlberg JE.

Department of Physiological Chemistry, University of Wisconsin, Madison 53706.

The spf gene of Escherichia coli encodes an unstable 109-nucleotide RNA, spot 42
RNA; the level of this RNA was reduced three- to fivefold when cells were grown
in the presence of 3',5'-cyclic AMP (cAMP). We show that this regulation occurs
through reduction in transcription and depends on both cAMP and the cAMP
receptor protein (CRP) but is independent of the de novo protein synthesis.
Through deletion analysis of the spf gene promoter, we have identified sequences
that are important in the synthesis of spot 42 RNA. Deletion of sequences
upstream of -77 completely eliminated the negative control of cAMP-CRP and
resulted in high constitutive levels of transcription. This region contained a
sequence that both conformed to the consensus binding site for cAMP-CRP in
positively regulated promoters and acted as a cAMP-CRP binding site in a gel
retardation assay. Deletion of sequences between positions -77 and -60 greatly
reduced the level of transcription in the presence or absence of cAMP-CRP,
indicating that at least part of this region is a binding site for a
positive-acting transcription factor (or RNA polymerase itself). We propose that
the proximity of the two sites defined here allows for the negative control of
spf gene transcription by cAMP-CRP. In particular, if only one site at a time
can be occupied, the binding of cAMP-CRP would interfere with the binding of a
transcription factor.

PMID: 2454912 [PubMed - indexed for MEDLINE]

345: Eur J Biochem. 1988 May 2;173(3):537-46. 

Fur (ferric uptake regulation) protein and CAP (catabolite-activator protein)
modulate transcription of fur gene in Escherichia coli.

De Lorenzo V, Herrero M, Giovannini F, Neilands JB.

Department of Biochemistry, University of California, Berkeley 94720.

A fusion between the fur (ferric uptake regulation) gene, known to mediate
negative regulation of iron absorption in Escherichia coli, and lacZ was
constructed in vitro. beta-Galactosidase levels of cells harboring this fusion
were under the control of sequences contained in a 185-bp DNA fragment located
upstream of the fur structural gene. The fusion was prepared in multicopy
(pVLN102 plasmid) and low-copy-number states, the latter constructed as a lambda
phage lysogen carrying a fur'-'lacZ insert. DNase I footprinting experiments
with purified Fur protein, performed on a 250-bp restriction fragment carrying
the promoter region of the fusion, showed the presence of a single Fur-protected
site overlapping the -10 region of a potential promoter sequence. Examination of
the DNA sequences located upstream of the fur gene revealed a possible binding
site for the catabolite-activator protein (CAP). beta-Galactosidase synthesis of
E. coli cells harboring the fusion were measured in fur, crp and cya genetic
backgrounds and compared with the corresponding levels in wild-type strains. The
data obtained indicate a moderate autoregulation of fur expression by its gene
product and also a significant stimulation by the cAMP-CAP system. Transcription
start sites were mapped by primer-extension experiments with total RNA obtained
in vivo from cells harboring pVLN102. The results show that transcription of the
fur gene is initiated from at least two different sites separated by 6 bp, which
appear to originate from two overlapping promoters sensitive to catabolic
activation.

PMID: 2836193 [PubMed - indexed for MEDLINE]

346: J Bacteriol. 1988 May;170(5):2352-8. 

A mutant crp allele that differentially activates the operons of the fuc regulon
in Escherichia coli.

Zhu Y, Lin EC.

Department of Microbiology and Molecular Genetics, Harvard Medical School,
Boston, Massachusetts 02115.

L-Fucose is used by Escherichia coli through an inducible pathway mediated by a
fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a
fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone
phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a
fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc
genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK,
and fucR. The positive regulator encoded by fucR responds to fuculose
1-phosphate as the effector. Mutants serially selected for aerobic growth on
propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but
noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that
restored growth on fucose caused constitutive expression of fucPIK. Results from
this study indicate that this suppressor mutation occurred in crp, which encodes
the cyclic AMP-binding (or receptor) protein. When the suppressor allele
(crp-201) was transduced into wild-type strains, the recipient became fucose
negative and fucose sensitive (with glycerol as the carbon and energy source)
because of impaired expression of fucA. The fucPIK operon became hyperinducible.
The growth rate on maltose was significantly reduced, but growth on L-rhamnose,
D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal.
Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+
restored normal growth ability on fucose. In contrast, lysogenization of
[fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their
growth on fucose.

PMID: 2834341 [PubMed - indexed for MEDLINE]

347: J Biolumin Chemilumin. 1988 Apr-Jun;2(2):81-93. 

The transcription of bacterial luminescence is regulated by sigma 32.

Ulitzur S, Kuhn J.

Department of Food Engineering and Biotechnology, Technion-Israel Institute of
Technology, Haifa.

Luminescence in the marine bacterium, Vibrio fischeri, is regulated by a small
molecule, the autoinducer. The transcription of the V. fischeri lux genes also
requires a regulatory protein, (luxR), cAMP and CRP. We show that, apart from
these components, the transcription of the PR lux operon is also controlled by
the activity of sigma 32 (htpR protein). In luminescent Escherichia coli (E.
coli/pChv1), as well as in different marine luminous bacteria and their
naturally occurring dark (K) variants, the luminescence system can be induced by
starvation under microaerophilic conditions. Heat shock also induces
luminescence in htpR+ but not in htpR- strains of E. coli/pChv1. An htpR- mutant
of E. coli containing pChv1 is very dim and its luminescence is not induced by
starvation or heat shock. The addition of a plasmid bearing the gene for htpR+
into such cells restores their response to starvation and heat shock. Cells of
wild type E. coli/pChv1 that have been starved or heat shocked respond to lower
concentrations of V. fischeri inducer than untreated cells. These cultures also
produce more extracellular inducer than untreated cells. Starvation, heat shock
and the presence of sigma 32 do not induce luminescence in luxl deleted E.
coli/pChv1 cells. SOS-inducing agents advance the onset of luminescence in both
htpR+ and htpR- strains but not in luxl deleted E. coli/pChvi cells. DNA
sequencing of the luxR-luxl region reveals the presence of a promoter region of
the kind typical for sigma 32 at the beginning of the luxl gene. In addition we
find a LexA protein-DNA binding site in the non-consensus sequence for the -35
region of the PR operon. It is proposed that the regulatory protein-inducer
complex displaces the LexA protein and allows the transcription of the right
operon. SOS-inducing agents result in proteolysis of LexA protein and advance
the onset of luminescence. sigma 32 enhances the transcription from the PR
operon and thus initiates a positive control circuit. It seems that sigma 32 is
the major controlling element in determining the onset of luminescence both in
vivo and in vitro.

PMID: 3063068 [PubMed - indexed for MEDLINE]

348: J Bacteriol. 1988 Mar;170(3):1092-102. 

Control of bacterial alkaline phosphatase synthesis and variation in an
Escherichia coli K-12 phoR mutant by adenyl cyclase, the cyclic AMP receptor
protein, and the phoM operon.

Wanner BL, Wilmes MR, Young DC.

Department of Biological Sciences, Purdue University, West Lafayette, Indiana
47907.

Mutant phoR cells show a clonal variation phenotype with respect to bacterial
alkaline phosphatase (BAP) synthesis. BAP clonal variation is characterized by
an alternation between a Bap+ and Bap- phenotype. The switching is regulated by
the phoM operon and the presence of glucose; the pho-510 mutant form of the phoM
operon abolishes both BAP clonal variation and the effect of glucose (B.L.
Wanner, J. Bacteriol. 169:900-903, 1987). In this paper we show that a mutation
of the adenyl cyclase (cya) and the cyclic AMP receptor protein (crp) gene also
abolish BAP clonal variation; either simultaneously reduces the amount of BAP
made in phoR mutants. Also, the pho-510 mutation is epistatic; it increases BAP
synthesis in delta cya phoR and delta crp phoR mutants. These data are
consistent with the wild-type phoM operon having a negative, as well as a
positive, regulatory role in gene expression. Furthermore, the data suggest that
adenyl cyclase and Crp indirectly regulate BAP synthesis in a phoR mutant via an
interaction with the phoM operon or its gene products. However, phoM operon
expression was unaffected when tested with phoM operon lacZ transcriptional
fusions. In addition, the switching Bap phenotype was not associated with an
alternation in phoM operon expression.

PMID: 3277944 [PubMed - indexed for MEDLINE]

349: J Bacteriol. 1988 Mar;170(3):1346-9. 

Regulation of ubiG gene expression in Escherichia coli.

Gibert I, Llagostera M, Barbe J.

Department of Genetics and Microbiology, Autonomous University of Barcelona,
Bellaterra, Spain.

To study the regulation of the expression in Escherichia coli of the ubiG gene,
which codes for the last enzyme in the pathway of ubiquinone biosynthesis, a
fusion between the ubiG and lacZ genes was constructed in vitro. The results
showed that (i) the expression of the ubiG gene was higher under aerobic
conditions than under anaerobic growth conditions, (ii) the presence of glucose
in the culture medium decreased the transcription of the ubiG gene, and (iii)
cya and crp mutants exhibited lower levels of ubiG gene expression than the
wild-type strain. The addition of cyclic AMP increased the expression of the
ubiG gene in both cya and wild-type strains but not in a crp mutant. This fact
suggests that the cyclic AMP receptor protein-cyclic AMP complex positively
modulates ubiG gene transcription. It was also determined that the transcription
of the ubiG gene was in the counterclockwise direction on the E. coli map.

PMID: 2830238 [PubMed - indexed for MEDLINE]

350: J Bacteriol. 1988 Jan;170(1):65-70. 

Cyclic AMP and cell division in Escherichia coli.

D'Ari R, Jaffe A, Bouloc P, Robin A.

Institut Jacques Monod, Paris, France.

We examined several aspects of cell division regulation in Escherichia coli
which have been thought to be controlled by cyclic AMP (cAMP) and its receptor
protein (CAP). Mutants lacking adenyl cyclase (cya) or CAP (crp) were rod
shaped, not spherical, during exponential growth in LB broth or glucose-Casamino
Acids medium, and lateral wall elongation was normal; in broth, stationary-phase
cells became ovoid. Cell mass was smaller for the mutants than for the wild
type, but it remained appropriate for their slower growth rate and thus probably
does not reflect early (uncontrolled) septation. The slow growth did not seem to
reflect a gross metabolic disorder, since the mutants gave a normal yield on
limiting glucose; surprisingly, however, the cya mutant (unlike crp) was unable
to grow anaerobically on glucose, suggesting a role for cAMP (but not for CAP)
in the expression of some fermentation enzyme. Both cya and crp mutants are
known to be resistant to mecillinam, an antibiotic which inhibits
penicillin-binding protein 2 (involved in lateral wall elongation) and also
affects septation. This resistance does not reflect a lack of PBP2. Furthermore,
it was not simply the result of slow growth and small cell mass, since small
wild-type cells growing in acetate remained sensitive. The cAMP-CAP complex may
regulate the synthesis of some link between PBP2 and the septation apparatus.
The ftsZ gene, coding for a cell division protein, was expressed at a higher
level in the absence of cAMP, as measured with an ftsZ::lacZ fusion, but the
amount of protein per cell, shown by others to be invariable over a 10-fold
range of cell mass, was independent of cAMP, suggesting that ftsZ expression is
not regulated by the cAMP-CAP complex.

PMID: 2826407 [PubMed - indexed for MEDLINE]

351: J Bacteriol. 1988 Jan;170(1):108-16. 

Double negative and positive control of tsx expression in Escherichia coli.

Bremer E, Gerlach P, Middendorf A.

Department of Biology, University of Konstanz, Federal Republic of Germany.

The Escherichia coli tsx gene encodes an outer membrane protein that is involved
in nucleoside uptake and serves as the receptor protein for colicin K and
several bacteriophages. Regulation of its expression was studied by using
tsx-lacZ protein and operon fusion strains carrying mutations in deoR, cytR, and
crp. The cytR-encoded repressor had a stronger influence on tsx transcription
than the DeoR repressor did, and the level of tsx expression in a deoR cytR
double mutant was approximately the sum of those found in the single deoR and
cytR strains. This double negative control of Tsx synthesis was superceded by a
positive control mechanism mediated by the cyclic AMP-catabolite activator
protein (cAMP-CAP) complex. Our results suggest that tsx expression is
controlled at two separate and differently regulated promoters: the weaker
promoter (P1) is repressible by DeoR, while the stronger promoter (P2) is
subject to negative and positive control by the CytR repressor and the cAMP-CAP
complex, respectively. A mutant was isolated that showed unaltered tsx
regulation by DeoR and the cAMP-CAP complex but strongly reduced repression by
CytR. This tsx operator mutant was used to obtain a suppressor mutation located
on a plasmid carrying the cloned cytR gene that restored CytR control of tsx
expression. The direction of tsx transcription was determined and found to be
counterclockwise on the E. coli chromosome.

PMID: 2826388 [PubMed - indexed for MEDLINE]

352: EMBO J. 1987 Dec 20;6(13):4227-34. 

A new target for CRP action at the malT promoter.

Menendez M, Kolb A, Buc H.

Institut Pasteur, Department de Biologie Moleculaire, France.

In Escherichia coli, the transcription of the malT gene is activated by the
complex formed between cAMP and its receptor protein, CRP. Kinetics of formation
of polyribonucleotide products from the corresponding promoter were studied in
vitro by two sets of techniques, abortive initiation assays and run-off
experiments. The first type of assay indicated that open complexes were formed
at malT with an equivalent efficiency, and at comparable rates, whether CRP-cAMP
was present or not. Secondary effects due to the activating complex were
observed (increased stability of the open complex, elimination of a weaker
binding site for the enzyme, improved Michaelis constants of RNA polymerase for
the substrates of the assay, UTP in particular). But, primarily, CRP-cAMP did
not exert a significant role in the rate of formation of the initiation complex.
In contrast, run-off assays showed that the yield of the full-length transcripts
was markedly enhanced by prior incubation of the DNA fragment with CRP-cAMP.
Both in the presence and in the absence of activator, the rate-limiting step for
this process was markedly slower than the formation of the initial open complex.
Short oligonucleotides (n less than 9), probably arising from a recycling
process, were found when the initiation complex was formed in the absence of
CRP-cAMP. They were abolished by prior incubation with the activator.
Unexpectedly, CRP-cAMP appears to favour the escape of RNA polymerase from the
initiation complex at this promoter.

PMID: 2832158 [PubMed - indexed for MEDLINE]

353: J Mol Biol. 1987 Aug 5;196(3):737-40. 

A class of Escherichia coli proteins controlled by the hflA locus.

Cheng HH, Echols H.

Department of Molecular Biology, University of California, Berkeley 94720.

The HflA protein of Escherichia coli is critical for the choice of the lytic or
lysogenic pathway by bacteriophage lambda. To investigate whether HflA plays a
regulatory role in E. coli, we used two-dimensional gel electrophoresis to
compare the distribution of E. coli proteins in hflA+ and hflA- cells. We found
at least 13 proteins that are present in hflA- strains, but absent or very low
in hflA+ strains. This observation indicates that HflA might be involved in
regulation of a large class of E. coli proteins. Because of prior work
implicating the Crp/cAMP system in Hfl-mediated regulation of lambda, we also
studied the distribution of E. coli proteins in cya- strains unable to
synthesize cAMP. Some of the same proteins found in hflA- are elicited by the
addition of cAMP to cya- cells.

PMID: 2824788 [PubMed - indexed for MEDLINE]

354: Can J Microbiol. 1987 Aug;33(8):704-8. 

Modulating action of cyclic AMP on the expression of two SOS genes in
Escherichia coli K-12.

Barbe J, Gibert I, Guerrero R.

Department of Genetics and Microbiology, Autonomous University of Barcelona,
Spain.

Ultraviolet irradiation and cyclic AMP treatment produce a synergistic effect on
the induction of the cle1 gene (coding for bacteriocin ColE1) in wild-type
strains of Escherichia coli. On the other hand, cyclic AMP does not affect the
uv-mediated induction of the recA, sfiA, and umuDC genes. Growth in the presence
of glucose or glycerol does not affect the factor of amplification of the
expression of the cle1 gene in uv-irradiated cells of the wild-type strain.
Although, in cultures not treated with uv, the basal level of cle1 induction is
about twice as high in cell grown grown with glycerol as in those using glucose
as carbon source. In recA mutants neither simultaneous nor separate treatments
with either cyclic AMP or uv irradiation induced transcription of the cle1 gene.
Moreover, cyclic AMP induced a slight increase in cle1 gene expression in
uv-irradiated cya strains, but not in the crp mutants. Nevertheless, the pattern
of the uv-mediated induction of other SOS genes, such as umuDC, was the same in
the cya and crp mutants, as in their parental wild-type strains. Furthermore,
the uv-mediated induction of lambda prophage was decreased after either addition
of cyclic AMP or growth in cultural conditions where the level of this
nucleotide was low.

PMID: 2825953 [PubMed - indexed for MEDLINE]

355: Mol Microbiol. 1987 Jul;1(1):53-8. 

Activation of the lac operon of Escherichia coli by a mutant FNR protein.

Spiro S, Guest JR.

Department of Microbiology, University of Sheffield, UK.

The FNR protein of E. coli is a transcriptional activator required for the
expression of genes involved in anaerobic respiratory pathways. Site-directed
mutagenesis was used to alter three amino acids in the recognition helix of the
putative DNA-binding domain of FNR, with the aim of changing its specificity to
that of the cyclic AMP receptor protein (CRP). In the presence of the mutant
protein (FNR-215) expression of the lac operon was activated during anaerobiosis
and unaffected by glucose. FNR-215 did not have a uniform effect on the
expression of other cAMP-CRP-dependent genes, but the results demonstrate the
fundamental similarity between FNR- and CRP-mediated transcriptional activation.

PMID: 2838728 [PubMed - indexed for MEDLINE]

356: Seikagaku. 1987 Jul;59(7):460-4. 

[Half interval method as a powerful tool for resolution of equation system
describing a biological phenomenon: application to simulation of transcription
regulation exercised by cAMP-CRP complex in E. coli]

[Article in Japanese]

Takahashi M.

PMID: 2836530 [PubMed - indexed for MEDLINE]

357: Mol Biol (Mosk). 1987 Jul-Aug;21(4):936-41. 

[The SOS and catabolytic repression systems can play a key role in the
regulation of infection of Escherichia coli cells with F-specific filamentous
phages M13, f1 and fd]

[Article in Russian]

Shumilov VIu.

Theoretical analysis of DNA sequences revealed recognition sites for two global
E. coli cellular regulons in M13, fd and fl phage's genomes. Both Px and Pv
promoters have SOS operator sequences and therefore must be repressed by the
lexA protein. PIII and PIV contains CRP-cAMP recognition sequences in activating
positions and hence will be activated by the cAMP receptor protein. The model is
proposed for the phage life cycle's control in the persistent infection of E.
coli cells by F-specific filamentous phages.

PMID: 2821384 [PubMed - indexed for MEDLINE]

358: J Mol Biol. 1987 Jun 20;195(4):795-808. 

Topological unwinding of strong and weak promoters by RNA polymerase. A
comparison between the lac wild-type and the UV5 sites of Escherichia coli.

Amouyal M, Buc H.

Departement de Biologie Moleculaire, Institut Pasteur, Paris, France.

Two Escherichia coli control regions have been compared in their ability to be
unwound by RNA polymerase during formation of the transcriptionally active
("open") complex: the wild-type control region, consisting of two overlapping
binding sites P1 and P2, both weakly transcribed, and an "up" P1 mutant, the
strong lac L8UV5 promoter. The final complexes were characterized by their
topological unwinding, by DNase I and orthophenanthroline footprints, as well as
by methylation of unpaired cytosine residues. At the wild-type control region,
the RNA polymerase footprint is weak, and single-strand formation is incomplete
and slow. The same signals are strong, complete and quickly established at lac
L8UV5; yet the final complexes were found to be equally unwound (by 1.7 turns)
in the absence of nucleotide substrates as well as during an abortive initiation
cycle. At the lac wild-type region, open complex formation occurs slowly enough
to permit the measurement of the extent of a single-stranded region and of
topological unwinding during the latency period. Not all the final species are
active and unwinding appears to precede, in time, full open-complex formation.
At the lac UV5 promoter the same conclusion was reached by a different method
involving those changes in the various parameters that characterize open-complex
formation monitored by an abortive initiation assay, conducted at increasing
levels of template superhelicity. From both approaches we conclude that, at
these promoters, the formation of the single-stranded region occurs at the
expense of a negative change in linking number, initially stored in a closed
intermediate, perhaps as negative writhing. Furthermore, abortive transcription
assays indicate that the specific initiation efficiency of the species stored at
both promoters, P1 and P2, on the wild-type template is increased as a whole
with increasing superhelicity (conversion of inactive species to active ones,
increased efficiency of active ones). We conclude that negative supercoiling is
not an extra-regulatory element of the lactose system, allowing modulation of
expression of the wild-type promoter to the profit of P1. Instead, P2 and P1, in
the absence of active catabolite receptor protein (CRP-cAMP), appear to be
equally weak and to be equally affected by negative supercoiling in the range of
superhelical densities examined. The physiological importance of the P1-P2
competition in the regulation of expression in this region is thus questioned.
The major effect of CRP-cAMP stimulation appears to be the direct activation at
the P1 promoter.

PMID: 3309341 [PubMed - indexed for MEDLINE]

359: Arch Microbiol. 1987 Mar;147(2):195-200. 

On the role of cyclic AMP and the Fnr protein in Escherichia coli growing
anaerobically.

Unden G, Duchene A.

The role of adenosine 3',5'-monophosphate (cAMP) and of the Fnr protein, a
transcriptional regulator of anaerobic electron transport, in the expression of
anaerobic respiration of Escherichia coli was investigated. Under conditions of
fermentation or anaerobic respiration intracellular cAMP was formed in
concentrations up to 4.6 nmol/g protein. From the enzymes of the anaerobic
electron transfer chain from glycerol-3-P to fumarate only the expression of
glycerol-3-P dehydrogenase (Freedberg WB, Lin ECC (1973) J Bacteriol
115:816-823), but not that of fumarate reductase required cAMP. Isolated Fnr
protein, which has been suggested to be an additional site of action of cAMP
under anaerobic conditions did not bind cAMP. It is concluded that cAMP in
anaerobic growth like in aerobic growth acts as the effector of CRP and that
catabolite repression plays an important regulatory role in anaerobic
catabolism. The Fnr protein was present in constant amounts (0.06 mg/g cellular
protein) and in constant molar mass (Mr 30,000) in aerobically and in
anaerobically grown bacteria. This result excluded regulation of the activity of
the Fnr protein by a change of concentration or by processing of the protein.

PMID: 3036034 [PubMed - indexed for MEDLINE]

360: Eur J Biochem. 1987 Feb 16;163(1):141-6. 

Modulation of human neutrophil function by C-reactive protein.

Buchta R, Fridkin M, Pontet M, Contessi E, Scaggiante B, Romeo D.

Investigation of the effect of C-reactive protein (CRP), an acute-phase
reactant, on the functional capacities of human neutrophils was carried out as
the basis for elucidating the biological function of C-reactive protein. An
initial stimulation at low concentrations, followed by inhibition of superoxide
production, and secretion of vitamin-B12-binding protein in the presence of two
stimulants, phorbol myristate acetate and concanavalin A, and of neutrophil
chemotaxis with increasing concentration of CRP was observed. Correlation
between modulation of cell function, at least at relatively high CRP
concentrations (greater than 50 micrograms/ml) and an increase in the
intracellular level of cAMP is suggested. CRP was also found to enhance
neutrophil phagocytosis of particles not containing phosphorylcholine, the
native CRP ligand. The proposed role of CRP in neutrophil function is one of
regulation and as a negative feedback for potential cytotoxic neutrophil
functions.

PMID: 3028793 [PubMed - indexed for MEDLINE]

361: Arch Microbiol. 1987;149(1):36-42. 

Cloning and sequence of the mdh structural gene of Escherichia coli coding for
malate dehydrogenase.

Vogel RF, Entian KD, Mecke D.

Physiologisch-Chemisches Institut im Medizinisch-Naturwissenschaftlichen
Forschungszentrum der Universitat Tubingen, Federal Republic of Germany.

The malate dehydrogenase gene of Escherichia coli, which is susceptible to
catabolite and anaerobic repression, has been cloned using plasmic pLC32-38 of
Clarke and Carbon (1976). The nucleotide sequence was determined of a 2.47 kbp
fragment, containing the mdh structural gene. All information necessary for
expression of the mdh structural gene was mapped within a 1.3 kbp SphI-BstEII
fragment. Compared with the untransformed wild type, transformations with pUC19
vector, containing this fragment, gave up to 40-fold more malate dehydrogenase
activity in both E. coli wild type and mdh mutant recipients. Catabolite
repression was not affected in the transformants. A possible CRP binding site in
the promotor region of the mdh gene provides evidence for a co-regulation with
fumA gene, the structural gene of fumarase, which is also subject to catabolite
repression. The structures for transcription initiation and termination were
similar to those previously described for E. coli. Amino acid sequence
homologies between pro- and eucaryotic malate dehydrogenases are discussed.

PMID: 3322223 [PubMed - indexed for MEDLINE]

362: Gene. 1987;56(1):87-97. 

Complete nucleotide sequence of the penicillin G acylase gene and the flanking
regions, and its expression in Escherichia coli.

Oh SJ, Kim YC, Park YW, Min SY, Kim IS, Kang HS.

Department of Microbiology, Seoul National University, Korea.

The pga gene coding for penicillin G acylase (PGA) in Escherichia coli ATCC11105
was cloned, and its complete nucleotide sequence including 5'- and 3'-flanking
regions was determined. Two nonidentical subunits that constitute an active PGA
enzyme complex are known to be formed by processing of a common precursor
molecule [Bock et al., FEMS Microbiol. Lett. 20 (1983) 141-144]. This novel type
of protein processing was confirmed by a nucleotide sequencing study together
with amino acid sequencing of two PGA subunits. In addition, it was found that
the initiation codon, AUG, is preceded by an authentic ribosome-binding site, a
consensus promoter sequence and putative cAMP receptor protein (CRP)-binding
sites, and that the termination codon, UAA, is followed by a putative
transcriptional terminator. The promoter function was confirmed by galactokinase
assay using galK fusion plasmids. A recombinant plasmid was constructed to
overproduce the enzyme using phage lambda pL promoter. Unexpectedly, thermal
induction led to accumulation of the 94-kDa polypeptide rather than active PGA
in large amounts. Western immunoblot analysis showed that this large polypeptide
is the real precursor of PGA. It is evident, therefore, that the synthesis of
active PGA in E. coli is affected by growth temperature and that the precursor
processing step(s) is temperature-sensitive.

PMID: 3315861 [PubMed - indexed for MEDLINE]

363: Gene. 1987;53(2-3):145-52. 

RNA polymerase makes important contacts upstream from base pair -49 at the
Escherichia coli galactose operon P1 promoter.

Busby S, Spassky A, Chan B.

A G:C to T:A transversion at bp position -19 in the gal operon promoter region
relieves the dependence of galP1 promoter activity on the cAMP-CRP complex.
Deletion analysis shows that expression from the promoter is decreased on
replacement of the sequence between 49 and 54 bp upstream from the P1 start
point. Moreover, protection experiments show that RNA polymerase interacts with
this region in open complexes at P1. We propose that this contact is necessary
for optimal P1 activity; point mutations in the gal promoter region can alter
DNA flexibility and hence the strength of this contact; CRP factor activates P1
transcription by favouring formation of this contact; and the gal repressor
blocks P1 activity by binding to this zone.

PMID: 3038692 [PubMed - indexed for MEDLINE]

364: Mol Biol (Mosk). 1987 Jan-Feb;21(1):200-23. 

[Minor promoters of phage phi X174 are controlled by CRP-cAMP, lexA, glnG and
several other common common regulatory systems of the host cell]

[Article in Russian]

Shumilov VIu.

It was found that CRP-cAMP-recognized sequences in DNA being suggested as
GTGN7-11CAC (with variability both in domain's structures and in spacer's
length) are located non-randomly in promoters. In CRP-cAMP-stimulated promoters
they lie upstream the "-35" box and are separated from it by a whole number of
DNA turns, whereas in CRP-cAMP-repressed ones they are located downstream "-35"
in a half-whole-turn-number distance. Several CRP-, SOS- and NR1-sites in the
phi X174 DNA sequence were found and a few new promoters were deduced from it.
PCRP1 lies within gene F and has both CRR and ntrC sites and one SOS-operator,
PCRP3 (in gene A) has a CRP site which overlaps with the SOS-operator, PA and
PCRP2 (in gene G) have sCRP and PD has a stringent discriminator. Four
promotors, PCRP1, PCRP2, PA and PB are cloned in the pBR322 plasmid. For cloned
PCRP1 the activation by exogenous cAMP and the SOS-induction by the mitomycin C
were observed in vivo in pVYB215-containing cells by increasing the levels of
beta-lactamase up to 27-fold. The new gene L of the phi X174 is deduced from the
DNA sequence. It has two start points, overlaps the gene F inside it and codes
for peptides 23 or 19 amino acids in length. These lethal peptides have strong
homology in sequence to the cellular protein sulA(sfiA) of E. coli, and L* can
cause observed filamentation and death of pVYB215- bearing cells after PCRP1
induction. In the A and A* protein sequences two domains "helix-turn-helix" were
found that are homologous to those in CRP and repressors; this makes possible
the competition between A* and CRT for its DNA sites that also have some
homology. The model of the phi X174 infection cycle control and mechanisms of
DNA recognition by CRP-CAMP are discussed. PCRP1 is the first promotor
controlled by both three global regulons of E. coli cell.

PMID: 3033474 [PubMed - indexed for MEDLINE]

365: J Biol Chem. 1986 Dec 15;261(35):16332-9. 

Structure-function analysis of three cAMP-independent forms of the cAMP receptor
protein.

Harman JG, McKenney K, Peterkofsky A.

cAMP receptor protein (CRP)-dependent operon expression in Escherichia coli
requires the CRP X cAMP complex form of wild-type CRP. One class of crp mutants
(crp*) activates CRP-dependent promoters in strains (cya) incapable of
endogenous cAMP synthesis. Of fundamental interest is the difference in
regulatory properties exhibited by crp* mutant strains, some of which exhibit
glucose-mediated repression of beta-galactosidase synthesis, some of which do
not. To gain a better understanding of the mechanisms of cAMP-independent
promoter activation and repression we have: determined through cloning and DNA
sequence analysis the primary structure of three CRP* forms of CRP; purified the
mutant proteins; characterized the effect of these mutations on CRP secondary
structure; and studied CRP*-activated lac promoter regulation in a purified in
vitro transcription system. The results of this study provide strong evidence
that mutations in crp alter the conformation of CRP and result in
cAMP-independent activation of CRP-dependent promoters in vitro. In addition, a
CRP allele-specific inhibition of CRP* activity by spermidine was observed in
vitro that parallels crp* strain-specific sensitivity to glucose-mediated
repression of CRP-dependent enzyme synthesis in vivo. This observation provides
evidence that catabolite repression in cells lacking cAMP may be mediated
through a mechanism that inhibits CRP* activity.

PMID: 3023348 [PubMed - indexed for MEDLINE]

366: J Bacteriol. 1986 Dec;168(3):1408-14. 

Expression of the adenylate cyclase gene during cell elongation in Escherichia
coli K-12.

Utsumi R, Kawamukai M, Aiba H, Himeno M, Komano T.

Expression of the adenylate cyclase gene (cya) in synchronized Escherichia coli
cells was investigated by using the cya-lacZ protein and operon fusion plasmids.
The regulation of cya expression during the cell cycle is characterized as
follows: cya is expressed during cell elongation; expression is repressed during
cell division; regulation is exerted at the transcriptional level. To test cya
expression during cell elongation, we constructed a plasmid (pLCR1) in which the
lacUV5 promoter operator was fused to the structural gene of cya and
investigated the effect of cya expression by
isopropyl-beta-D-thiogalactopyranoside (IPTG) on the cell division of cells
containing pLCR1. By the addition of IPTG, cell division was inhibited and
filaments were formed. Such an inhibitory effect was antagonized by adding
cyclic GMP to the culture medium and was not observed in the crp mutant.

PMID: 3536877 [PubMed - indexed for MEDLINE]

367: J Mol Biol. 1986 Sep 5;191(1):39-58. 

Novel regulatory mutants of the phosphate regulon in Escherichia coli K-12.

Wanner BL.

New pleiotropic mutants were isolated that express either the phoA, psiE or psiO
promoter constitutively and simultaneously alter bacterial alkaline phosphatase
regulation, carbon utilization or ultraviolet light sensitivity. To do this,
Lac+ mutants were isolated from strains with the appropriate lacZ
transcriptional fusions. Over 300 independent mutants were characterized, and
all that constitutively express phoA map in phoR, phoU, the phosphate-specific
transport system or a new locus called phoF. However, only phoU mutants express
both phoA and psiE constitutively. Carbohydrate-utilizing mutants that show
constitutive expression of psiE and psiO map in cya, crp and, possibly, crr.
Also, numerous ultraviolet-light-sensitive mutants were discovered that show
increased psiO expression and map in lon. Some other mutations that lead to
constitutive psiO expression (which is normally induced either by phosphate,
nitrogen or carbon starvation or anoxia) show decreased expression of phoA.
Also, several mutants were found that show an unusual metastable character
affecting psiO or phoA transcription. In these, colonies spontaneously switch
between an induced and repressed "state" with respect to lac or bacterial
alkaline phosphatase expression. In some, the clonal variation of the lactose
phenotype or bacterial alkaline phosphatase synthesis is recA-independent and
phenotypically resembles phase variation in Salmonella typhimurium. The latter
class are called "phase mutants". The mutants are discussed in terms of
protein-nucleic acid interactions and/or possible changes in the DNA, i.e.
modifications or rearrangements, within the phosphate gene system, that are
physiologically regulated.

PMID: 3540312 [PubMed - indexed for MEDLINE]

368: J Biol Chem. 1986 Aug 25;261(24):11091-6. 

Expression of the type I regulatory subunit of cAMP-dependent protein kinase in
Escherichia coli.

Saraswat LD, Filutowicz M, Taylor SS.

An expression vector has been constructed for the type I regulatory subunit of
cAMP-dependent protein kinase. A cDNA clone for the bovine RI-subunit has been
inserted into pUC7. When Escherichia coli JM105 was transformed with this
plasmid, R-subunit was expressed in amounts that approached 4 mg/liter. The
expressed protein was visualized in total cell extracts by photolabeling with
8-azidoadenosine 3':5'-mono[32P]phosphate following transfer from sodium dodecyl
sulfate-polyacrylamide gels to nitrocellulose. Expression of R-subunit was
independent of isopropyl-beta-D-thiogalactopyranoside. R-subunit accumulated in
large amounts only in the stationary phase of growth, and the addition of
isopropyl-beta-D-thiogalactopyranoside during the log phase of growth actually
blocked the accumulation of R-subunit. Maximum expression (20 mg/liter) was
achieved when E. coli 222 was transformed with the RI-containing plasmid. E.
coli 222 is a strain that contains two mutations; it is cya- and also has a
mutation in the catabolite gene activator protein (crp) that enables the protein
to bind to DNA in the absence of cAMP. The expressed RI-subunit was a soluble,
dimeric protein, and no significant proteolysis was apparent in the cell
extract. The purified RI-subunit bound 2 mol of cAMP/mol of R monomer,
reassociated with C-subunit to form holoenzyme, and migrated as a dimer on
sodium dodecyl sulfate-polyacrylamide gels in the absence of reducing agents.
The expressed protein was also susceptible to limited proteolysis, yielding a
monomeric cAMP-binding fragment having a molecular weight of 35,000. In all of
these properties, the expressed protein was indistinguishable from RI purified
from bovine tissue even though the R-subunit expressed in E. coli represents a
fusion protein that contains 10 additional amino acids at the amino terminus
that are provided by the lac Z' gene of the vector. This NH2-terminal sequence
was confirmed by amino acid sequencing.

PMID: 3525560 [PubMed - indexed for MEDLINE]

369: J Bacteriol. 1986 Aug;167(2):616-22. 

Cloning and DNA sequence analysis of the wild-type and mutant cyclic AMP
receptor protein genes from Salmonella typhimurium.

Schroeder CJ, Dobrogosz WJ.

The crp gene from Salmonella typhimurium, as well as two mutant adenylate
cyclase regulation genes designated crpacr-3 and crpacr-4, were cloned into the
EcoRI site of plasmid pUC8. Initially cloned on 5.6-kilobase fragments isolated
from EcoRI digests of chromosomal DNA, these genes were further subcloned into
the BamHI-EcoRI site of plasmid pBR322. When tested, Escherichia coli crp
deletion strains harboring the clones regained their ability to pleiotropically
ferment catabolite-repressible sugars. Also, the crpacr-containing strains
displayed sensitivity to exogenous cyclic AMP (cAMP) when grown on
eosin-methylene blue medium with xylose as the carbon source. The proteins
encoded by the S. typhimurium wild-type and mutant crp genes were found to have
similar molecular weights when compared with the wild-type cAMP receptor protein
(CRP) from E. coli. DNA sequence analysis of the wild-type crp gene showed only
a three-nucleotide difference from the E. coli sequence, suggesting little
divergence of the crp gene between these organisms. The crpacr sequences,
however, each contained single nucleotide changes resulting in amino acid
substitutions at position 130 of the CRP. Based on the site at which these
substitutions occur, the crpacr mutations are believed to affect CRP-cAMP
interactions.

PMID: 3015882 [PubMed - indexed for MEDLINE]

370: Proc Natl Acad Sci U S A. 1986 Jul;83(14):5000-4. 

Mechanism for the autogenous control of the crp operon: transcriptional
inhibition by a divergent RNA transcript.

Okamoto K, Freundlich M.

Expression of the crp gene is negatively autoregulated by the complex of cyclic
AMP and its receptor protein (cAMP-CRP). We find a second promoter in this
region that is strongly activated in vitro and in vivo by cAMP-CRP.
Transcription from this promoter is initiated 3 nucleotides upstream and on the
opposite strand from the start of crp mRNA. The addition of the purified 5'
segment of the divergent RNA specifically inhibits crp transcription in vitro.
cAMP-CRP does not block crp expression if the new promoter is altered so that
divergent RNA cannot be made. The initial nucleotides of the divergent RNA are
complementary to 10 of the first 11 nucleotides of the crp mRNA. Since the next
11 nucleotides of crp mRNA are A + U-rich, and RNA hybrid between the divergent
RNA and the 5' end of crp mRNA could produce a structure similar to a
rho-independent terminator, leading to inhibition of crp transcription.

PMID: 2425359 [PubMed - indexed for MEDLINE]

371: Biochem J. 1986 Jun 15;236(3):643-9. 

Overproduction of the cyclic AMP receptor protein of Escherichia coli and
expression of the engineered C-terminal DNA-binding domain.

Gronenborn AM, Clore GM.

Overproduction of the cyclic AMP receptor protein (CRP) from Escherichia coli,
up to 25% of the soluble cell protein, has been achieved in an inducible
host-vector system under transcriptional control of the lambda promoter PL. This
system is ideally suited for large scale production and purification of CRP. In
addition, a structural gene for the DNA-binding domain of CRP has been
constructed. To this end the nucleotide sequence coding for the C-terminus was
fused to the sequence coding for the first 10 N-terminal amino acids and cloned
into suitable vectors. Good expression was achieved using the lambda PL
promoter. The gene product, beta CRP, is recognized by anti-CRP antibodies.

PMID: 3539103 [PubMed - indexed for MEDLINE]

372: J Bacteriol. 1986 Jun;166(3):884-91. 

Osmoregulation of the maltose regulon in Escherichia coli.

Bukau B, Ehrmann M, Boos W.

The maltose regulon consists of four operons that direct the synthesis of
proteins required for the transport and metabolism of maltose and maltodextrins.
Expression of the mal genes is induced by maltose and maltodextrins and is
dependent on a specific positive regulator, the MalT protein, as well as on the
cyclic AMP-catabolite gene activator protein complex. In the absence of an
exogenous inducer, expression of the mal regulon was greatly reduced when the
osmolarity of the growth medium was high; maltose-induced expression was not
affected, and malTc-dependent expression was only weakly affected. Mutants
lacking MalK, a cytoplasmic membrane protein required for maltose transport,
expressed the remaining mal genes at a high level, presumably because an
internal inducer of the mal system accumulated; this expression was also
strongly repressed at high osmolarity. The repression of mal regulon expression
at high osmolarity was not caused by reduced expression of the malT, envZ, or
crp gene or by changes in cellular cyclic AMP levels. In strains carrying
mutations in genes encoding amylomaltase (malQ), maltodextrin phosphorylase
(malP), amylase (malS), or glycogen (glg), malK mutations still led to elevated
expression at low osmolarity. The repression at high osmolarity no longer
occurred in malQ mutants, however, provided that glycogen was present.

PMID: 2423504 [PubMed - indexed for MEDLINE]

373: J Bacteriol. 1986 May;166(2):533-40. 

Cloning and molecular characterization of csm mutations allowing expression of
catabolite-repressible operons in the absence of exogenous cyclic AMP.

George SE, Melton T.

The cyclic AMP (cAMP) suppressor mutation (csm) of Escherichia coli has been
cloned from strain NCR30 in the HindIII-EcoRI site of pBR322. This mutation has
been mapped in or near the crp gene. Wild-type crp DNA hybridized to recombinant
plasmids pGM5 and pGM25 containing the cloned csm mutation. These recombinant
plasmids encoded a protein product of identical molecular weight and charge as
that of the wild-type cAMP receptor protein. Transformants of cya crp deletion
strains harboring pBM5 or pGM25 exhibited phenotypic characteristics common to
strain NCR30. These included the expression of catabolite-repressible enzymes,
such as arabinose isomerase, tryptophanase, beta-galactosidase, and threonine
deaminase; the expression of chemotactic and motility genes; cAMP sensitivity;
and the accumulation of toxic levels of methylglyoxal. DNA sequence analysis
indicated that the Csm suppressor phenotype was attributable to the insertion of
a guanosine residue 17 base pairs downstream from the termination codon of the
crp structural gene. The guanosine insertion is located in the stem region of
the presumed transcriptional termination loop. This stem region contained a
unique BssHII restriction site which was used to construct an in vitro deletion
in the wild-type crp insert in plasmid pHA7. The resulting plasmid, pGM459,
renders transformants having a phenotype common to that conferred by the
chromosomal or cloned csm mutation. Our results indicate a novel role for the 3'
flanking region of the crp structural gene in the expression of the cAMP
receptor protein.

PMID: 3009405 [PubMed - indexed for MEDLINE]

374: Genetika. 1986 Apr;22(4):576-83. 

[Construction of the hybrid crp-lac operon and study of the role of CRP-cAMP
complex in its regulation in Escherichia coli]

[Article in Russian]

Smirnov IuV, Lisenkov AF.

Phage Mu d1(Ap,lac) was used to construct the hybrid crp-lac operon in
Escherichia coli cells possessing crps mutation which increases sensitivity of
bacterial growth to exogenous cAMP. Transcription of the structural lac genes in
this hybrid operon was initiated from the promoter region of the crp gene. By
measuring levels of beta-galactosidase enzyme, the maximal transcription of the
crp gene was obtained in strains with cya or crp mutations causing inactivation
of the CRP - cAMP complex. Restoration of cya+crp+ genotype resulted in 5 to 7
times decrease of the lacZ gene activity. At the concentration of exogenous cAMP
which induces catabolic derepression in the wild-type strain, the expression of
crp-lac operon increased 2-3 times. Using F'ts114lac-mediated chromosome
mobilization, the direction of transcription of the crp gene was found to be
counterclockwise, relative to the E. coli genetic map.

PMID: 3089871 [PubMed - indexed for MEDLINE]

375: J Gen Microbiol. 1986 Mar;132(3):697-705. 

A DNA sequence containing the control sites for the uxaB gene of Escherichia
coli.

Blanco C, Mata-Gilsinger M.

The nucleotide sequence of a 286 bp fragment containing the uxaB control region
of Escherichia coli has been determined. The transcriptional start of the uxaB
gene has been located and the promoter signals identified. Various fragments of
the uxaB promoter-proximal region were fused in vitro with the lacZ gene.
Results obtained with these fusions indicate that the operator-promoter sites
are located on a 110 bp restriction fragment. The determination of the amino
acid sequence of the NH2-terminus of the uxaB gene product revealed that the
uxaB gene is not initiated with the AUG codon but with the unusual GTG codon.
CRP, the cyclic AMP receptor protein, does not bind to the uxaB control region
DNA even though expression of the uxaB gene is sensitive to catabolite
repression.

PMID: 3525742 [PubMed - indexed for MEDLINE]

376: EMBO J. 1985 Dec 30;4(13B):3887-93. 

Transcriptional activation of a pap pilus virulence operon from uropathogenic
Escherichia coli.

Baga M, Goransson M, Normark S, Uhlin BE.

A gene cluster mediating production of pili in uropathogenic Escherichia coli
was analysed with respect to regulation of pili synthesis. Two cistrons, papB
and papI, were localized upstream of the major pilus subunit gene, papA. The
papI-papB-papA region was characterized by nucleotide sequencing and by
transcriptional analysis. The papA gene was primarily represented by an 800
nucleotide long transcript but was also co-transcribed with papB as a less
abundant 1300 nucleotide long mRNA. Both transcripts presumably terminated at
the same site downstream of the papA coding sequence. The weakly expressed papI
gene was transcribed in the opposite direction to that of papB and papA. Studies
with lacZ operon fusions showed that the papB gene encoded a trans-active
effector required for papA transcription. Similarly, the papI gene stimulated
papB transcription in trans. Furthermore, full expression of papA was cis
dependent upon the papI-papB region. Transcription of the papB gene was shown to
be dependent upon cAMP and its receptor protein. A binding site for the cAMP-CRP
complex was postulated in the DNA sequence upstream of the papB promoter.

PMID: 2868893 [PubMed - indexed for MEDLINE]

377: J Biol Chem. 1985 Nov 25;260(27):14838-43. 

Evidence for negative control of cya transcription by cAMP and cAMP receptor
protein in intact Escherichia coli cells.

Mori K, Aiba H.

The transcriptional regulation of cya by cAMP and its receptor protein (CRP) has
been studied by S1 nuclease and RNA dot blot assays. The crp- Escherichia coli
cells were shown to produce about 5-fold more cya mRNA than do the wild type
cells. The effect of cAMP and CRP on the cya transcription was directly examined
by introducing a crp plasmid into the cells and/or by adding cAMP exogenously.
The levels of cya mRNA in crp+ cells decreased with increasing concentrations of
cAMP in the growth medium. The repressive effect of cAMP on cya transcription
was strongly enhanced in cells carrying a multicopy crp plasmid. These results
indicate that the cya transcription is negatively regulated by cAMP-CRP complex
in intact cells.

PMID: 2414300 [PubMed - indexed for MEDLINE]

378: J Bacteriol. 1985 Nov;164(2):872-7. 

Negative regulation of adenylate cyclase gene (cya) expression by cyclic
AMP-cyclic AMP receptor protein in Escherichia coli: studies with cya-lac
protein and operon fusion plasmids.

Kawamukai M, Kishimoto J, Utsumi R, Himeno M, Komano T, Aiba H.

We constructed cya-lac protein and operon fusion plasmids in vitro. The effect
of cyclic AMP (cAMP) on cya expression was examined by measuring the synthesis
of beta-galactosidase in Escherichia coli cells containing fused plasmids. In
the cya-lacZ fused protein system, cya expression was strongly repressed by
exogenous cAMP. Functional cAMP receptor protein (CRP) was necessary for this
effect. On the other hand, in a tet-lacZ fused protein as a control system, tet
expression was not affected by cAMP. The inhibition of cya expression by cAMP
was also observed in the cya-lac fused operon system, although it was necessary
to increase the amount of cAMP or CRP in the cells to detect the effect. The
results indicate that cAMP-CRP is a negative regulator of cya expression at the
level of transcription.

PMID: 2997135 [PubMed - indexed for MEDLINE]

379: J Bacteriol. 1985 Oct;164(1):45-50. 

Control of Vibrio fischeri luminescence gene expression in Escherichia coli by
cyclic AMP and cyclic AMP receptor protein.

Dunlap PV, Greenberg EP.

Under certain conditions glucose represses the autoinducible synthesis of
luminescence enzymes in Vibrio fischeri. To examine the genetic regulation of
luminescence more closely, Escherichia coli catabolite repression mutants were
transformed with a plasmid (pJE202) that contains V. fischeri genes specifying
the luminescence enzymes and encoding regulatory functions for luminescence (the
lux genes) or with plasmids (pJE413 and pJE455) containing transcriptional
fusions between the lacZ gene on transposon mini-Mu and specific genes in each
of the two lux operons. Unless cyclic AMP (cAMP) was added to the growth medium,
an adenylate cyclase deletion mutant containing pJE202 produced very little
light and low levels of the light-emitting enzyme luciferase. When grown in the
presence or absence of cAMP, a cAMP receptor protein (CRP) deletion mutant
produced low levels of light and luciferase. A mutant that does not make cAMP
but does make an altered CRP which does not require cAMP for activity produced
induced levels of luminescence after transformation with pJE202. To test the
effects of cAMP and CRP on each of the two lux operons separately rather than on
both together, the E. coli catabolite repression mutants were transformed with
pJE413 and pJE455. From measurements of beta-galactosidase and luciferase
activities it appeared that cAMP and CRP affected transcription of both lux
operons. In the presence of autoinducer and its receptor, transcription of the
operon encoding all of the luminescence genes except the receptor gene appeared
to be activated by cAMP and CRP, whereas in the absence of the receptor, cAMP
and CRP appeared to decrease transcription of this operon. Transcription of the
operon encoding the autoinducer receptor appeared to be stimulated by cAMP and
CRP in the absence of the receptor itself. These results demonstrate that cAMP
and CRP are required for proper control of the V. fischeri luminescence system
and suggest that lux gene transcription is required by a complex mechanism.

PMID: 2995319 [PubMed - indexed for MEDLINE]

380: J Bacteriol. 1985 Sep;163(3):1191-5. 

Multiple controls exerted on in vivo expression of the pepN gene in Escherichia
coli: studies with pepN-lacZ operon and protein fusion strains.

Gharbi S, Belaich A, Murgier M, Lazdunski A.

Three physiological conditions were shown to promote transcriptional regulation
of pepN expression: phosphate limitation, the nature of the source of carbon and
energy, and anaerobiosis. The transcriptional level of regulation can be deduced
from the observation of these effects in strains carrying operon fusion
pepN-lacZ. Mutations in the various genes phoB, phoM, phoR, crp, and fnr (oxrA)
did not affect pepN expression.

PMID: 2863254 [PubMed - indexed for MEDLINE]

381: Nucleic Acids Res. 1985 Jul 11;13(13):4687-98. 

Positive regulation of the colicin E1 gene by cyclic AMP and cyclic AMP receptor
protein.

Shirabe K, Ebina Y, Miki T, Nakazawa T, Nakazawa A.

In previous experiments, we showed that the in vivo transcription of the colicin
E1 gene was dependent on cyclic AMP in adenylate cyclase-defective mutant cells
of Escherichia coli (Ebina, Y. and Nakazawa, A (1983) J. Biol. Chem. 258,
7072-7078). We now show that cyclic AMP and cyclic AMP receptor protein
stimulated the in vitro transcription of the gene in the presence of spermidine.
As determined in DNase I protection experiments, two binding sites for the
complex of cyclic AMP and the receptor protein were identified about 60 base
pairs (CRP-1) and 110 base pairs (CRP-2) upstream from the transcription
initiation site of the colicin E1 gene. CRP-1 had a higher affinity for the
complex than that of CRP-2. Substituting an unrelated DNA sequence for CRP-2
reduced the efficiency of in vitro stimulation of the gene by cyclic AMP and the
receptor protein. These potential binding sites for the cyclic AMP-cyclic AMP
receptor protein complex probably participate in the stimulation of the colicin
E1 gene transcription.

PMID: 2991844 [PubMed - indexed for MEDLINE]

382: Mol Gen Mikrobiol Virusol. 1985 Jul;(7):24-6. 

[Effect of mutations damaging cyclic adenosine-3',5'-monophosphate receptor
protein on the expression of catabolic operons in Escherichia coli delta ptsH
K12]

[Article in Russian]

Glezina ML, Bol'shakova TN, Gershanovich VN.

Effectivity of expression of catabolite operons is repressed in bacteria with
altered cytoplasmic components of the sugar, transport system (pts mutants).
Mutation crp* changing the ability of the cyclic adenosine-3',5'-monophosphate
receptor protein to activate transcription leads to suppression of the pts
mediated disturbance of the enzyme inducible synthesis. This suppression
manifests in ability of double delta ptsH crp* mutants to utilize different
substrates and in restoration of the rate of beta-galactosidase synthesis and
L-tryptophanase synthesis up to the levels in wild type bacteria.

PMID: 3916230 [PubMed - indexed for MEDLINE]

383: J Bacteriol. 1985 Feb;161(2):641-9. 

Regulation of a cya-lac fusion by cyclic AMP in Salmonella typhimurium.

Jovanovich SB.

cya-lac and crp-lac operon fusions were isolated in Salmonella typhimurium by
using the phage Mu d1(lac cts Apr). Both transduction and reversion analyses
have indicated that lac expression is controlled by the appropriate promoter,
e.g., either crpp or cyap. By using chromosomal mobilization techniques, we
found that cya had a clockwise direction of transcription on the standard S.
typhimurium map. The cya-lac fusions could be complemented by Escherichia coli
F'133, which covers cya, with a resultant 17 to 38% decrease in cya expression.
Cyclic AMP was found to be able to repress the expression of the cya-lac fusion
ninefold when present at 25 mM. This repression was not seen in crp backgrounds,
and hence is mediated by the cAMP receptor protein. Repression of cya was also
found upon growth on carbon sources known to elicit high cyclic AMP levels.

PMID: 2981819 [PubMed - indexed for MEDLINE]

384: J Bacteriol. 1985 Jan;161(1):454-7. 

Regulation of expression of the crp gene of Escherichia coli K-12: in vivo
study.

Cossart P, Gicquel-Sanzey B.

Expression of the crp gene was studied in vivo by use of a crp-lacZ gene fusion
first constructed on a plasmid and then transferred onto the chromosome. Our in
vivo data confirm the in vitro findings that crp is negatively autoregulated via
the cyclic AMP-catabolite gene activator protein complex. We present evidence
that gene crp is repressed by glucose.

PMID: 2981809 [PubMed - indexed for MEDLINE]

385: J Bacteriol. 1984 Dec;160(3):833-41. 

Regulation of expression of the ilvB operon in Salmonella typhimurium.

Weinberg RA, Burns RO.

The ilvB gene of Salmonella typhimurium encodes the valine-sensitive form of
acetohydroxy acid synthase, acetohydroxy acid synthase I, which catalyzes the
first step in the parallel biosynthesis of isoleucine and valine. Although
nearly all of the other genes involved in this pathway are clustered at minute
83, ilvB was found to lie at minute 80.5. Expression of ilvB was shown to be
nearly completely repressed by the end products leucine and valine. Studies in
which we used strains with mutations in cya (adenylate cyclase) and crp (cAMP
receptor protein) demonstrated that synthesis of acetohydroxy acid synthase I is
enhanced by the cAMP-cAMP receptor protein complex. Although no stimulation was
achieved by growth on poor carbon sources, introduction of crp on a multicopy
plasmid led to markedly increased expression. Strains of S. typhimurium lacking
valine-resistant acetohydroxy acid synthase II (ilvG) are like Escherichia coli
K-12 in that they are not able to grow in the presence of L-valine owing to a
conditional isoleucine auxotrophy. The valine toxicity of these ilvG mutants of
S. typhimurium was overcome by increasing the level of acetohydroxy acid
synthase I. Enzyme activity could be elevated either by maximally derepressing
expression with severe leucine limitation, by introduction of either ilvB or crp
on a multicopy plasmid, or by the presence of the ilv-513 mutation. This
mutation, which is closely linked to genes encoding the phosphoenol
pyruvate:sugar phosphotransferase system (pts), causes highly elevated
expression of ilvB that is refractory to repression by leucine and valine, as is
the major ilv operon. The response of ilvB to the cAMP-cAMP receptor protein
complex was not affected by this lesion. Data obtained by using this mutant led
us to propose that the two modes of regulation act independently. We also
present some evidence which suggests that ilvB expression may be affected by the
phosphoenol pyruvate:sugar phosphotransferase system.

PMID: 6094508 [PubMed - indexed for MEDLINE]

386: Gene. 1984 Nov;31(1-3):205-11. 

Studies on deo operon regulation in Escherichia coli: cloning and expression of
the deoR structural gene.

Short SA, Singer JT.

Recombinant plasmid pBR322 derivatives containing the Escherichia coli deoR
structural gene (coding for one repressor of the deo operon) and a mutant allele
of the cmlA gene (chromosomally encoded chloramphenicol resistance) have been
constructed and the positions of these genes on a 6.3-kb EcoRI fragment have
been determined. Transformation of an E. coli deoR single mutant with any of the
deoR+ plasmids resulted in complementation of the chromosomal deoR mutation.
More importantly, however, transformation of a deoR cytR double mutant with the
deoR+ plasmids also resulted in complete repression of Deo enzyme synthesis.
Based on these data, we conclude that transcription of the deo operon initiating
from both the cAMP/CRP-independent promoter-operator site, PO1, and the
cAMP/CRP-dependent promoter-operator site, PO2, is negatively controlled by the
deoR-encoded repressor, whereas the cytR-encoded repressor regulates deo operon
expression only from the cAMP/CRP-dependent promoter-operator site, PO2.

PMID: 6098525 [PubMed - indexed for MEDLINE]

387: FEBS Lett. 1984 May 21;170(2):321-5. 

Cyclic AMP and anaerobic gene expression in E. coli.

Unden G, Guest JR.

The expression of the fumarate reductase system of Escherichia coli is
completely dependent on the presence of adenylate cyclase or cyclic AMP, but the
cyclic AMP receptor protein (CRP) is not required. This suggests that cyclic AMP
may function as an effector for a second gene activator protein, possibly Fnr,
and thus form part of a redox-sensitive regulatory mechanism controlling the
expression of anaerobic respiratory functions.

PMID: 6327384 [PubMed - indexed for MEDLINE]

388: J Bacteriol. 1984 Feb;157(2):552-9. 

Antagonistic transcriptional regulation of the putrescine biosynthetic enzyme
agmatine ureohydrolase by cyclic AMP and agmatine in Escherichia coli.

Satishchandran C, Boyle SM.

The putrescine biosynthetic enzyme agmatine ureohydrolase (AUH) (agmatinase; EC
3.5.3.11) catalyzes the conversion of agmatine to putrescine in Escherichia
coli. The specific activity of AUH was determined in crude extracts prepared
from wild-type strains and from strains with mutations in the adenylate cyclase
gene (cya) or the cAMP receptor protein gene (crp) or both. In glucose minimal
medium, a delta cya strain exhibited 70 to 90% higher AUH activity than a cya+
strain. Addition of 1 to 10 mM cAMP to cya+ and delta cya strains cultured in
glucose repressed AUH activity in a dose-dependent manner. Addition of 1 to 10
mM cAMP to a delta crp strain failed to repress AUH activity. Addition of
agmatine resulted in a three- to fourfold induction of AUH in delta cya and
delta crp strains. This induction could be blocked by the addition of
chloramphenicol. Simultaneous additions of various proportions of cAMP and
agmatine resulted in reduced levels of induction and repression of AUH activity.
This antagonistic regulation was shown to be exerted by independent mechanisms
since AUH activity could be induced by agmatine in a delta crp strain
supplemented with cAMP. These results suggest that both agmatine and cAMP
antagonistically regulate AUH activity at the level of transcription. In minimal
medium supplemented with 1 mM putrescine, the strains did not exhibit repression
of AUH activity. In contrast, in minimal medium supplemented with 1 mM ornithine
or arginine, cya+ or delta cya strains exhibited induced AUH activity as a
result of conversion of these substrates to agmatine. Further experiments in
vitro demonstrated that the effects observed with cAMP, agmatine, and arginine
were not post-translationally mediated.

PMID: 6319366 [PubMed - indexed for MEDLINE]

389: Mol Gen Genet. 1984;198(1):159-65. 

Anomalous expression of the E. coli lac operon in Proteus mirabilis. I. Effects
of L8 and L8 UV5.

Roberts M, Baumberg S.

The lac operon shows anomalous expression in Proteus mirabilis: the maximal
induced level is 10% or less of that in E. coli, while repression reduces this
by a factor of only 2-5. We have sought to determine whether this effect relates
in any way to CRP-mediated activation of expression, by comparing expression in
P. mirabilis of lac operons (introduced for technical reasons on IncP1 plasmids)
either regulatorily wild-type or bearing L8 or L8UV5. Derivatives of RP1 bearing
L8UV5 were obtained by homogenotisation of pGC9114 (RP1::Tn951) in a L8UV5
background; while derivatives of RP4 bearing lac+, L8 or L8UV5 were obtained by
Mu-mediated translocation of chromosomal regions bearing these alleles,
following partial heat-induction of Mucts62 on pGM14 (RP4::Mucts62) in the
appropriate hosts. These plasmids could be readily transferred to, and stably
maintained in, the P. mirabilis strains employed. It was found that L8 reduced
the maximal level of beta-galactosidase activity, and L8UV5 restored this
activity to around wild-type, in P. mirabilis quantitatively very much as in E.
coli. Nevertheless, the low maximal level of expression and high basal level
characteristic of the former host were unchanged. The simplest explanation of
these results is that P. mirabilis contains a protein that mimics the E. coli
CRP protein in interacting with the appropriate DNA binding site and thereby
stimulating transcription; and that the anomalous regulation of lac in this host
is unconnected with the CRP system.

PMID: 6441102 [PubMed - indexed for MEDLINE]

390: J Mol Biol. 1983 Nov 15;170(4):861-82. 

Mutations in the promoter regions of the malEFG and malK-lamB operons of
Escherichia coli K12.

Bedouelle H.

The malB region of Escherichia coli is composed of two operons, malEFG and
malK-lamB, transcribed divergently from a control region located between the
malE and malK genes. Expression of the malB operons is under the positive
control of the malT gene product (MalT) and maltose and of the crp gene product
(CRP) and cyclic AMP. Strains in which the lac genes have been fused to malE or
malK are unable to use lactose as carbon source if they have been deleted for
malT or crp. Mutations in the malB region allowing such fusion strains to grow
on lactose have been isolated. These and previously isolated mutations were
genetically characterized. As regards the malEp promoter mutations, malEp9,
malEp1 and malEp6 create new promoters that are MalT and CRP independent. malEp9
and malEp1 change residues -1 and -2, respectively, of malEp without altering
its activity. malEp6 duplicates six base-pairs between residues -22 and -23.
malEp3 improves the -10 region hexamer. malEp5 deletes residues -29 to -62. It
creates a new promoter that is MalT independent, CRP dependent, likely by fusing
together functional regions of malEp that are normally apart. malEp5 also
reduces the expression of malK-lamB, suggesting the existence of a link between
the malEp and malKp promoters. As regards the malKp mutations, malKp6 changes
residue -81 of malKp without altering its activity. It creates a new promoter,
which is MalT independent, CRP dependent, likely by using a pre-existing cyclic
AMP/CRP binding site. malKp102 changes residue -36, two bases upstream of the
-35 region hexamer. It decreases the activity of malKp by at least four orders
of magnitude and likely alters the MalT binding site. These results are
discussed in terms of regulatory interactions within the malB control region.

PMID: 6417341 [PubMed - indexed for MEDLINE]

391: Genetika. 1983 May;19(5):714-9. 

[Cloning of the gene controlling catabolite repression with the participation of
cyclic adenosine monophosphate in Escherichia coli K-12]

[Article in Russian]

Lisenkov AF, Smirnov IuV, Sukhodolets VV.

The crp gene coding for cyclic adenosine monophosphate receptor protein has been
cloned on the vehicle pBR325 using restriction endonuclease PstI and the
recipient strain C600 crp. The pCAP2 hybrid plasmid obtained has a molecular
weight 7.0 MD and in the pBR325 with the insertion into a PstI site. Bacterial
clones carrying pCAP2 restore Crp+ phenotype, as judged by the capacity of
bacteria for utilization of various carbohydrates and by the activity of
catabolite sensitive enzymes.

PMID: 6307813 [PubMed - indexed for MEDLINE]

392: J Biol Chem. 1983 Mar 25;258(6):3813-24. 

Regulation of bacterial glycogen synthesis. Stimulation of glycogen synthesis by
endogenous and exogenous cyclic adenosine 3':5'-monophosphate in Escherichia
coli and the requirement for a functional CRP gene.

Leckie MP, Ng RH, Porter SE, Compton DR, Dietzler DN.

In Escherichia coli cya mutants, deficient in adenylate cyclase (EC 4.6.1.1),
basal cellular rates of glycogen synthesis were lower and the relative increases
produced by exogenous cyclic adenosine 3',5'-monophosphate during growth on
glucose were greater than in their respective parent strains. These observations
provide strong evidence that endogenous cyclic AMP is one of the key regulators
of glycogen synthesis in growing E. coli. In crp mutants, deficient in cyclic
AMP receptor protein (CRP), the basal cellular rates of glycogen synthesis were
much lower than in their respective parent strains. Stimulation of glycogen
synthesis by exogenous cyclic AMP was markedly attenuated in the three crp
mutants. Thus, stimulation of glycogen synthesis by either endogenous or
exogenous cyclic AMP appears to require CRP. Functional CRP appeared to be
required for all three responses observed after cyclic AMP addition: an abrupt
step-up in the cellular rate of glycogen synthesis, a continuing exponential
increase in rate, and a stimulation of the rate during a subsequent nitrogen
starvation. To account for these responses, we derived a mathematical model in
which the cyclic AMP-CRP complex regulates the differential rate of synthesis of
an enzyme metabolizing an effector of the rate-limiting enzyme of glycogen
synthesis.

PMID: 6300058 [PubMed - indexed for MEDLINE]

393: Nucleic Acids Res. 1983 Jan 11;11(1):127-39. 

Nucleotide sequence of the ilvB multivalent attenuator region of Escherichia
coli K12.

Hauser CA, Hatfield GW.

The ilvB gene of Escherichia coli K12 has been cloned into a multicopy plasmid.
The regulation of the cloned gene by valine or leucine limitation and by
catabolite repression is the same as for the chromosome encoded gene. The
nucleotide sequence of a regulatory region preceding the ilvB structural gene
has been determined. This DNA sequence includes a promoter, a region which codes
for a putative 32 amino acid polypeptide containing multiple valine and leucine
codons, and a transcription termination site. In vitro transcription of this
region produces a 184 nucleotide terminated leader transcript. Mutually
exclusive secondary structures of the leader transcript are predicted. On the
basis of these data, a model for multivalent attenuation of the ilvB operon is
presented. Data are presented which suggests that at least part of the
postulated CRP-cyclic AMP binding site of the ilvB operon precedes the
transcription start site by more than 71 base pairs.

PMID: 6346263 [PubMed - indexed for MEDLINE]

394: Mol Gen Genet. 1983;190(3):417-20. 

Effect of ptsI and ptsH mutations on initiation of transcription of the
Escherichia coli lactose operon.

Glesyna ML, Bolshakova TN, Gershanovitch VN.

Mutations in the pts genes (which code for the enzyme I and HPr protein - the
general components of the phosphoenolypyruvate-dependent phosphotransferase
system) lead to decreases in enzyme-inducible synthesis at the level of
transcription. The intracellular content of cyclic AMP in the ptsIH mutant was
severely diminished, while the ptsH bacteria contain the same amounts of this
nucleotide as the wild-type cells. Nevertheless expression of the lac operon was
diminished in the ptsH as well as in the ptsIH mutant. The exogenous cyclic AMP
did not prevent repression of beta-galactosidase synthesis in a delta cya ptsI
mutant in a wide range of concentrations in the growth medium (from 0.05 mM to 5
mM). The combination of ptsI or ptsH mutations with rpoC1 (synthesis of
thermosensitive beta' subunit of RNA polymerase) leads to greater disturbance of
beta-galactosidase production at the nonpermissive temperature than demonstrated
in the pts+ rpoC1 strain. The stimulatory effect of exogenous cyclic AMP was
more pronounced in pts rpoC1 than in pts+ rpoC1 bacteria. The data presented
confirm the hypothesis that pts mutations alter the function of CRP in
initiation of transcription.

PMID: 6308397 [PubMed - indexed for MEDLINE]

395: Mol Gen Genet. 1983;190(1):27-34. 

Cyclic AMP and its receptor protein are required for expression of transfer
genes of conjugative plasmid F in Escherichia coli.

Kumar S, Srivastava S.

A number of cya and crp mutants of Escherichia coli HfrH were analyzed for
several Tra functions of the F plasmid. The mutants were observed to be
deficient in conjugal donor ability, absorption of phages MS2 and Q beta and
surface exclusion. These defects were suppressed in cya mutants grown with cAMP
supplementation. A cAMP concentration of 3 X 10(-4) M produced maximal
suppression of donor ability defect in a cya strain. cAMP did not suppress the
Tra- phenotype of crp mutants. Latent periods of MS2 were shorter in cya and crp
bacteria. Phage T7 development appeared similar in wild type, cya, and crp
cells. It is concluded that tra genes of F plasmid are expressed only to a small
extent in cya and crp mutants and that cAMP and its receptor protein are
required for the normal expression of tra genes.

PMID: 6304473 [PubMed - indexed for MEDLINE]

396: Cell. 1983 Jan;32(1):141-9. 

Autoregulation of the Escherichia coli crp gene: CRP is a transcriptional
repressor for its own gene.

Aiba H.

The restriction fragments carrying the region preceding the Escherichia coli crp
structural gene were transcribed. The 5' end of the crp mRNA was determined by
RNAase partial digestion and S1 digestion methods. Thus the crp gene has been
shown to possess a 167 bp leader. CRP-cAMP specifically prevents the crp
transcription. In other words, the crp gene is regulated autogenously. DNAase
foot-printing studies indicated that CRP-cAMP binds to the crp gene at positions
+26 to +67. This region exhibits a striking sequence homology to the CRP-binding
sites in other genes. CRP and RNA polymerase bind to the crp regulatory region
simultaneously. These results suggest a different mechanism for transcriptional
repression of the crp gene by CRP-cAMP from that of a typical operator-repressor
model.

PMID: 6297782 [PubMed - indexed for MEDLINE]

397: Proc Natl Acad Sci U S A. 1982 Oct;79(20):6156-60. 

Nucleotide sequence of the ilvB promoter-regulatory region: a biosynthetic
operon controlled by attenuation and cyclic AMP.

Friden P, Newman T, Freundlich M.

The DNA sequence of the promoter-regulatory region of the ilvB operon of
Escherichia coli was determined. This region encodes a potential leader
polypeptide containing 32 amino acids, 12 of which are the regulatory amino
acids valine and leucine. Approximately 50 residues downstream from the coding
region for the potential leader peptide is a site for terminating transcription.
In vitro transcription experiments show that transcription terminates at this
site and produces a leader mRNA of approximately equal to 188 nucleotides. A
model for the multivalent regulation of this operon by valyl- and leucyl-tRNA is
proposed on the basis of the mutually exclusive formation of five strong
stem-and-loop structures in the leader mRNA. In addition, the -35 and -70
regions of this sequence show close structural homologies to areas in cyclic AMP
receptor protein (CRP)-dependent promoters reported to be important for CRP
function. In vitro transcription from the ilvB promoter was greatly increased by
cyclic AMP and CRP. Taken together, these data strongly suggest that the ilvB
biosynthetic operon is negatively controlled by multivalent transcription
termination and is positively regulated by cyclic AMP and CRP.

PMID: 6292893 [PubMed - indexed for MEDLINE]

398: J Bacteriol. 1982 Sep;151(3):1346-57. 

Regulation of adenylate cyclase synthesis in Escherichia coli: studies with
cya-lac operon and protein fusion strains.

Bankaitis VA, Bassford PJ Jr.

We have isolated cya-lac operon and protein fusions in Escherichia coli K-12,
and we used these to study the regulation of cya, the structural gene for
adenylate cyclase. Data obtained from these fusion strains suggest that neither
cyclic AMP (cAMP) nor the cAMP receptor protein plays a major role in
transcriptional or translational regulation of cya expression. Modulation of
intracellular cAMP concentrations elicited only weak repression of cya-lac
fusion activity under conditions of high intracellular cAMP, relative to fusion
activity under conditions of low intracellular cAMP. The functional cAMP
receptor protein was required for this effect. Incorporation of delta crp into
cya-lac fusion strains did not affect fusion expression in glucose-grown cells
as compared with similarly cultured isogenic crp+ strains. Furthermore, 20
independently obtained mutants derived from a cya-lacZ protein fusion strain
exhibiting a weak Lac+ phenotype were isolated, and it was determined that the
mutants had beta-galactosidase activities ranging from 2- to 77-fold greater
than those of the parental strain. None of the mutations responsible for this
increase in fusion activity map in the crp locus. We used these mutants to aid
in the identification of a 160,000-dalton cya-lacZ hybrid protein. Finally,
chromosome mobilization experiments, using cya-lac fusion strains, allowed us to
infer a clockwise direction of transcription for the cya gene relative to the
standard E. coli genetic map.

PMID: 6286596 [PubMed - indexed for MEDLINE]

399: J Bacteriol. 1982 May;150(2):722-9. 

Role of the catabolite activator protein in the maltose regulon of Escherichia
coli.

Chapon C.

The maltose regulon consists of three operons controlled by a positive
regulatory gene, malT. Deletions of the gene crp were introduced into strains
which carried a malT-lacZ hybrid gene. From the observed reduction in
beta-galactosidase activity it was concluded that the expression of malT-lacZ,
and therefore of malT, is controlled by the catabolite activator protein (CAP),
the product of the gene crp. Mutations were obtained which allowed a malT-lacZ
hybrid gene to be expressed at a high level even in the absence of CAP. These
mutations were shown to be located in or close to the promoter of the malT gene
and were called malTp. The malTp mutations were transferred in the cis position
to a wild-type malT gene. In the resulting strains, the expression of two of the
maltose operons, malEFG and malK-lamB, still required the action of CAP, whereas
that of the third operon, malPQ, was CAP independent. Therefore, in wild-type
cells, CAP appears to control malPQ expression mainly, if not solely, by
regulating the concentration of MalT protein in the cell. On the other hand, it
controls the other two operons more stringently, both by regulating malT
expression and by a more direct action, probably exerted in the promoters of
these operons.

PMID: 7040340 [PubMed - indexed for MEDLINE]

400: Genetika. 1982;18(6):939-46. 

[Regulation of uridine phosphorylase gene activity in Escherichia coli K-12. II.
A study of the nature of the constitutive synthesis of uridine phosphorylase in
the rho15(ts) genome]

[Article in Russian]

Mironov AS.

The nature of uridine phosphorylase constitutive synthesis was studied in the
rho15(ts) mutant strain of Escherichia coli. The rho15 mutation causes the 8-10
fold increase in uridine phosphorylase activity under conditions of both
induction of enzyme synthesis by cytidine and complete inhibition of the udpP
promoter activity in the crp background. These data indicate that regulation of
the udp gene which is controlled by the cytR repressor protein and by cyclic AMP
-- CRP complex, is disturbed in the presence of the mutated rho factor.
Introduction of the rho15 mutation into the udpP1 and udpP18 promoter mutants
which are characterized by cytR and (or) CRP independent expression of the udp
gene, leads to 2 fold reduction in uridine phosphorylase activity. From this, it
may be concluded that the presence in bacteria of the rho15 mutation prevents
transcription initiation from the intact udpP+ promoter and also leads to udpP1
and udpP18 mutant promoters inhibition. On the basis of these data, it is
proposed that the effect of rho15 mutation on the udp gene expression is rather
due to read-through transcription from an upstream highly efficient foreign
promoter, than to relief of attenuation within the udp gene regulatory region.
The uridine phosphorylase activity under control of this foreign promoter, i.e.
in the rho15 genome, is reduced 2-3 fold when bacteria are grown on the minimal
medium supplemented with L-methionine or casaamino acids. Based on these dat, it
is suggested that increased udp gene expression in the rho15 background is due
to read-through transcription, possibly, from the promoter of the neighbouring
metE gene.

PMID: 7049835 [PubMed - indexed for MEDLINE]

401: Mol Gen Genet. 1982;187(1):157-61. 

Influence of the rho-15 temperature-sensitive (ts) mutation on the expression of
the deo-operon in Escherichia coli.

Sukhodolets VV, Mironov AS, Linkova EV.

In the rho-15 temperature-sensitive (ts) mutant deo-operon enzymes show no
sensitivity to catabolite repression and are not derepressed under the influence
of a constitutive regulatory mutation, cytR. These data suggest that intact
Rho-protein along with CRP protein is necessary for a catabolite sensitive
deo-operon promoter cytP to work. In addition, there are data suggesting that
Rho-factor and CRP-protein interact with each other in regulation of the
deo-operon. Thus, in studies of the effect of the rho-15 (ts) and crp mutations,
maximum deo-enzyme levels have been found in the double rho-15 (ts) crp mutant,
and therefore intact Rho-protein in the crp genome or intact CRP-protein on the
rho-15 (ts) background seems to be an obstacle for the deoP promoter in the
deo-operon. In rho-15 (ts) a relative increase has been observed in the enzyme
activity for a distal purine nucleoside phosphorylase gene with respect to a
proximal thymidine phosphorylase gene. However in crp, the rho-15 (ts) mutation
has no effect on the polarity gradient, that is on the background of impaired
CRP protein Rho-factor does not seem to work as a transcription terminator
within the operon.

PMID: 6819427 [PubMed - indexed for MEDLINE]

402: EMBO J. 1982;1(9):1049-54. 

Tandem CRP binding sites in the deo operon of Escherichia coli K-12.

Valentin-Hansen P.

The locations of DNA binding by the cyclic AMP receptor protein (CRP) in the deo
operon of Escherichia coli have been determined by the DNase I footprinting
procedure. Two high affinity sites were found around positions -35 and -90,
preceding the second deo promoter. In vitro data on induction of gene fusions
that join different parts of the deoP -2 regulatory region to the lac genes
suggest that: (1) both CRP binding sites are needed for high expression from the
deoP -2 region; and (2) negative regulation by the cytR repressor is
accomplished by preventing the cAMP-CRP complex from binding to the second
target.

PMID: 6329724 [PubMed - indexed for MEDLINE]

403: Mol Gen Genet. 1982;187(2):291-6. 

crpX mutants of Escherichia coli K12: specific regulatory effects of altered
cyclic AMP receptor proteins.

Guiso N, Joseph E, Daniel J.

We attempted to correlate structural modifications of the adenosine 3',5' cyclic
monophosphate (cAMP) receptor protein (CAP), to changes in some of its in vivo
regulatory functions such as (i) stimulation of the lactose operon expression
and (ii) control of adenylate cyclase activity. A radioimmunological procedure
was used to study the structure of CAP synthesized by three mutants (crpX) grown
under various conditions, in the presence or absence of endogenous or exogenous
cAMP. In one mutant CAP appears to be sensitive to thermal inactivation. In
another mutant CAP is particularly sensitive to degradation in the absence of
cAMP; this degradation is enhanced by high temperature and during stationary
phase of growth, and prevented by the addition of glucose. Functional
alterations of CAP were not found to follow structural changes strictly. In the
crpX mutants and in strains carrying the crp+ or other crp allele, the
stimulation of the lactose operon expression and the modulation of the in vivo
rates of cAMP synthesis appear to vary in parallel, favoring an indirect
mechanism of regulation of adenylate cyclase by CAP.

PMID: 6294464 [PubMed - indexed for MEDLINE]

404: Mol Gen Genet. 1982;185(2):262-8. 

Multiple regulation of the activity of adenylate cyclase in Escherichia coli.

Joseph E, Bernsley C, Guiso N, Ullmann A.

We have studied the correlation between the activities of adenylate cyclase (ATP
pyrophosphatelyase-(cyclizing); EC 4.6.1.1) and in vivo rates of synthesis and
intracellular concentrations of adenosine 3',5' cyclic monophosphate (cAMP)
under various growth conditions in wild-type Escherichia coli and in mutants
lacking or overproducing the cAMP receptor protein (CAP). We showed that when
wild-type bacteria are grown in the presence of a variety of carbon sources the
intracellular concentrations of cAMP are inversely related to the adenylate
cyclase activities determined in permeabilized cells, suggesting that the carbon
source-dependent modulation of cAMP levels is not directly related to the
regulation of adenylate cyclase activity. In mutants lacking functional CAP
(crp) the in vivo rates of cAMP synthesis are several hundred-fold higher than
in the wild-type parent without a parallel increase of adenylate cyclase
activities. In a strain carrying multiple copies of the crp gene and
overproducing CAP the activity of adenylate cyclase is severely inhibited,
although the in vivo rate of cAMP synthesis is similar to the parental strain.
We interpret these results as indicating that CAP controls mainly the activity
rather than the synthesis of adenylate cyclase.

PMID: 6283317 [PubMed - indexed for MEDLINE]

405: Ann Microbiol (Paris). 1982 Jan;133A(1):77-80. 

Role of the catabolite activator protein in the expression of the maltose
regulon of Escherichia coli.

Chapon C.

Using malT-lacZ strains deleted for gene crp, we have shown that the expression
of malT is controlled by the catabolite activator protein (CAP), the product of
gene crp. malT X mutations were obtained which allowed a malT-lacZ hybrid gene
to be expressed at a high level even in the absence of CAP. These mutations were
shown to be located in or close to the promoter of the malT gene. We transferred
the malT X mutation cis to a wild type malT gene. In the resulting strains, the
study of the expression of the three operons in absence or presence of CAP led
us to the following conclusion. CAP appears to control malPQ expression mainly
if not only by regulating the concentration of MalT protein in the cell. On the
other hand it controls the two other operons more stringently both by regulating
malT expression and by a more direct action probably exerted on the promoters of
these operons.

PMID: 6280543 [PubMed - indexed for MEDLINE]

406: J Bacteriol. 1981 Dec;148(3):753-61. 

Isolation and characterization of an Escherichia coli mutant affected in the
regulation of adenylate cyclase.

Guidi-Rontani C, Danchin A, Ullmann A.

A mutant, cyaR1, affecting regulation of adenylate cyclase expression or
activity is described. It was obtained as a thermoresistant revertant of a
strain harboring a thermosensitive transcription termination factor, rho
(rho-15). This mutant failed to synthesize adenosine 3',5'-phosphate and
exhibited a carbohydrate-negative phenotype. A secondary mutation at the crp
locus (crpC) restored the ability of the mutant to synthesize adenosine
3',5'-phosphate, enabled the expression of catabolite-sensitive operons, and
conferred on the strain an extreme sensitivity to catabolite repression. In
addition, we showed that the crpC mutation restored the pleiotropic
carbohydrate-positive phenotype even in a delta cya background. We interpret
this to mean that the adenosine 3',5'-phosphate receptor protein regulates
negatively either the activity or synthesis of adenylate cyclase and that the
cyaR1 mutation is either in a regulatory protein or a regulatory site of
adenylate cyclase.

PMID: 6273380 [PubMed - indexed for MEDLINE]

407: J Bacteriol. 1981 Aug;147(2):500-8. 

Cyclic adenosine 3',5'-monophosphate-mediated hyperinduction of araBAD and
lacZYA expression in a crp mutant of Escherichia coli K-12.

Bankaitis VA, Kline EL.

A spontaneous lac+ revertant of an adenylate cyclase deletion strain of
Escherichia coli K-12 was isolated and characterized. This revertant, designated
strain KC20, exhibited a pleiotropic suppression of the adenylate cyclase
defect, with the crp locus being the site of the suppressor mutation. Cyclic
adenosine 3',5'-monophosphate at an exogenous concentration of 1 mM severely
inhibited the growth of strain KC20 in minimal media. Lower concentrations of
the cyclic nucleotide elicited less pronounced effects. Studies on araBAD and
lacZYA expression showed that cyclic adenosine 3',5'-monophosphate elicited an
initial dose-dependent hyperinduction of these systems. Hyperinduction of
araBAD, in L-arabinose grown cultures of strain KC20, resulted in accumulation
of inhibitory concentrations of methylglyoxal. Hyperinduction of lacZYA in
lactose-grown cultures of strain KC20 did not result in any such methylglyoxal
production.

PMID: 6267010 [PubMed - indexed for MEDLINE]

408: Cell. 1981 Jul;25(1):241-9. 

Differential translation efficiency explains discoordinate expression of the
galactose operon.

Queen C, Rosenberg M.

We have used an mRNA-dependent E. coli S-30 translation system to compare the
translation efficiencies of two polycistronic transcripts of the galactose
operon, the CRP-cAMP-dependent mRNA (P1) and the CRP-cAMP-independent mRNA (P2).
The RNAs were prepared in vitro, quantitated by hybridization or gel analysis
and translated in a cell free system. The specific protein products were
measured, and their quantities were compared with the amount of input mRNA. Our
results show that the P2 mRNA synthesizes epimerase, the 5'-proximal gene
product of the gal operon, four times more efficiently than the P1 mRNA. The
5'-distal gene products, transferase and kinase, are translated with the same
efficiency from both transcripts. Thus the ratio of epimerase to kinase
synthesis is four times higher for the P2 mRNA than for the P1 mRNA. This change
in epimerase to kinase ratio is identical to that observed in vivo when the
cellular cAMP level falls and gal transcription is believed to switch from P1 to
P2. We suggest that it is the differential translation efficiency of the
epimerase gene on the two different gal transcripts that accounts for this
discoordinate expression. Moreover, since the P2 mRNA differs from the P1 mRNA
only by the addition of five nucleotides at the 5' terminus and these
nucleotides are outside the ribosome binding region we determine for epimerase,
the selective difference in the translation efficiency of epimerase is probably
mediated by RNA conformation.

PMID: 7023696 [PubMed - indexed for MEDLINE]

409: J Bacteriol. 1981 Feb;145(2):722-8. 

Catabolite repression of Escherichia coli heat-stable enterotoxin activity.

Martinez-Cadena MG, Guzman-Verduzco LM, Stieglitz H, Kupersztoch-Portnoy YM.

The Escherichia coli heat-stable enterotoxin (ST) coded for by plasmid pYK007
(Apr ST+) showed a dependence for cyclic adenosine 3',5'-monophosphate (cAMP) to
express ST activity in an adenyl cyclase (cya) deletion mutant; no ST activity
was detected in the presence of cAMP in a cAMP receptor protein (crp) deletion
mutant or in a double deletion mutant (delta cya delta crp). The cya-crp effect
on ST activity could not be accounted for by a modification of the copy number
of plasmid deoxyribonucleic acid per chromosome equivalent or by an alteration
in the secretion of an active intracellular enterotoxin.

PMID: 7007347 [PubMed - indexed for MEDLINE]

410: Genetika. 1981;17(10):1719-29. 

[Disturbance of the tandem promotor functioning of the Escherichia coli K-12
deo-operon in the genome of the rho15(ts) mutant for the transcription
termination factor]

[Article in Russian]

Sukhodolets VV, Mironov AS, Lin'kova EV.

The effect of the rho15(ts) mutation on the expression of Escherichia coli deo
operon's genes is studied. In relation to the regulatory deoR and cytR genes,
the rho15 mutation causes in wild type genome 2,5-fold increase in both
thymidine phosphorylase (deoA gene) and purine nucleoside phosphorylase (deoD
gene) activity, while the deoxyriboaldolase activity controlled by the proximal
deoC gene almost does not differ in the rho+ and rho15 strains. The effect of
rho15 for the expression of the deo genes in constitutive deoR genome depends on
the allele of crp gene: in the crp+ bacteria rho15 leads to a decrease, while in
the crp bacteria - to an essential increase in the activity of deo enzymes.
These data suggest a possible role of CRP protein as an inhibitor of
transcription initiated from deoP promoter. The presence of rho15 in a bacterial
genome leads to the complete block of the cytP promoter activity under
conditions of both induction of deo enzymes by cytidine and their depression in
cytR genome. Based on these data, it is proposed that proximal to cytP promoter,
i. e. between deoP and ctyP a Rho-dependent attenuator is located which is
usually responsible for termination of the deoP-initiated transcription. An
activity of the inner deo operon OP3 promoter is possibly also inhibited in the
rho15 genome as shown by the data on the absence of induction of purine
nucleoside phosphorylase by inosine in the rho15 bacteria.

PMID: 7030866 [PubMed - indexed for MEDLINE]

411: Mol Gen Genet. 1981;183(3):522-7. 

Transcription regulation of colicin Ib synthesis.

Pugsley AP.

Bacteriophage Mud (Casadaban and Cohen 1979) was used to bring the transcription
of the gene for beta galactosidase (lacZ) under the control of the promoter of
the structural gene for colicin Ib (cia(Ib)) on a derivative of the Col plasmid
Col-Ib.P9. Transcription of this fusion operon was stimulated by agents which
damaged cellular DNA (mitomycin C, bleomycin and colicin E2). Increased
transcription of the cia-lacZ operon could be detected within 13 min of the
addition of these agents. In a strain bearing the tif-1 (recA441) mutation,
constitutive expression of the SOS DNA repair system at 42 degree C also
increased transcription of the cia-lacZ operon. Transcription of the cia-lacZ
operon was also stimulated by inhibition of DNA gyrase activity with nalidixic
acid but not with novobiocin. Transitory inhibition of protein synthesis with
chloramphenicol or by proline starvation of a proline auxotroph did not
stimulate cia-lacZ transcription. Transcription of the cia-lacZ operon was
substantially reduced in the presence of a recA mutation, but was largely
unaffected by a mutation in recB affecting the RecBC DNase or by catabolite
repression. Control experiments in which the production of colicin Ib was
measured confirmed that the experiments with the fusion operon gave an accurate
indication as to the activity of the wild type cia gene except for the effect of
catabolite repression, where we observed up to 99% reduction in colicin Ib
production in strains carrying mutant crp or cya alleles. The overall results
confirm previous suggestions that there was considerable similarity between the
regulatory systems controlling production of colicins and the
repressor-dependent regulation of lambdoid prophage induction.

PMID: 6460913 [PubMed - indexed for MEDLINE]

412: Mol Gen Genet. 1981;182(3):480-9. 

Isolation and characterization of cAMP suppressor mutants of Escherichia coli
K12.

Melton T, Snow LL, Freitag CS, Dobrogosz WJ.

We have isolated spontaneous and chemically induced revertants of cya mutant
strains of Escherichia coli. Three different classes of revertants were
obtained. One class consisted of primary site revertants; a second class was
pseudorevertants that had phenotypically reverted to wild type but retaining the
original cya mutant and the third class of revertants, designated csm, were
pseudorevertants hypersensitive to exogenous cAMP. Transductional analysis of
the csm mutation indicated the mechanism of suppression in these strains was
intergenic. The csm mutation and hypersensitivity to cAMP map in or near the crp
gene. Growth of the csm strains on PTS (phosphoenolpyruvate phosphotransferase
system) and non-PTS substrates was inhibited by 5 mM cAMP. The csm strains were
found to accumulate toxic levels of methylglyoxal when grown on non-PTS
substrates in the presence of exogenous cAMP. All csm strains were sensitive to
catabolite repression mediated by alpha-methylglucoside. Revertants selected as
resistant to cAMP fell into four major classes that could be distinguished by
their fermentation patterns in the presence and absence of cAMP as well as by
their growth response to streptomycin in the presence of cAMP.

PMID: 6272064 [PubMed - indexed for MEDLINE]

413: Mol Gen Genet. 1981;181(4):470-5. 

Regulation of the synthesis of adenylate cyclase in Escherichia coli by the cAMP
-- cAMP receptor protein complex.

Majerfeld IH, Miller D, Spitz E, Rickenberg HV.

The synthesis of the adenylate cyclase [ATP pyrophosphatelyase-(cyclizing), E.C.
4.6.1.1.] of Escherichia coli, appears to be regulated negatively by the cAMP
receptor protein, CRP. This conclusion is based on a comparison of adenylate
cyclase activities measured in vitro with the rates of cAMP synthesis by intact
bacteria. The activity of adenylate cyclase, depending on conditions of growth,
is also regulated by CRP; this effect, however, is indirect insofar as it is
mediated by a protein or proteins under CRP control.

PMID: 6267421 [PubMed - indexed for MEDLINE]

414: Proc Natl Acad Sci U S A. 1980 Oct;77(10):5799-801. 

Catabolite repression in Escherichia coli mutants lacking cyclic AMP receptor
protein.

Guidi-Rontani C, Danchin A, Ullmann A.

Pleiotropic carbohydrate-positive pseudorevertants have been isolated from a
specific class of rho-crp double mutants of Escherichia coli carrying both
defective transcription termination protein, rho, and cyclic AMP receptor
protein. The modulation of catabolite repression of beta-galactosidase,
amylomaltase, and tryptophanase has been studied in the pseudorevertants. It has
been found that these mutants exhibit catabolite repression. Because
catabolite-sensitive operons can be expressed in the absence of functional
cyclic AMP receptor protein, this would suggest on the one hand that the cyclic
AMP-receptor protein complex is not the exclusive mediator of catabolite
repression and on the other hand that rho might be involved in the regulation of
catabolite-sensitive operons.

PMID: 6255466 [PubMed - indexed for MEDLINE]

415: J Bacteriol. 1980 Feb;141(2):770-8. 

Metabolite gene regulation: imidazole and imidazole derivatives which circumvent
cyclic adenosine 3',5'-monophosphate in induction of the Escherichia coli
L-arabinose operon.

Kline EL, Bankaitis VA, Brown CS, Montefiori DC.

Imidazole, histidine, histamine, histidinol phosphate, urocanic acid, or
imidazolepropionic acid were shown to induce the L-arabinose operon in the
absence of cyclic adenosine 3',5'-monophosphate. Induction was quantitated by
measuring the increased differential rate of synthesis of L-arabinose isomerase
in Escherichia coli strains which carried a deletion of the adenyl cyclase gene.
The crp gene product (cyclic adenosine 3',5'-monophosphate receptor protein) and
the araC gene product (P2) were essential for induction of the L-arabinose
operon by imidazole and its derivatives. These compounds were unable to
circumvent the cyclic adenosine 3',5'-monophosphate in the induction of the
lactose or the maltose operons. The L-arabinose regulon was catabolite repressed
upon the addition of glucose to a strain carrying an adenyl cyclase deletion
growing in the presence of L-arabinose with imidazole. These results
demonstrated that several imidazole derivatives may be involved in metabolite
gene regulation (23).

PMID: 6245056 [PubMed - indexed for MEDLINE]

416: Mol Gen Genet. 1980;179(2):457-60. 

Regulation of the synthesis of nucleoside catabolic enzymes in Escherichia coli:
further analysis of a deo Oc mutant strain.

Albrechtsen H, Ahmad SI.

Four genes, deoA, deoB, deoC, and deoD, involved in the synthesis of nucleoside
and deoxynucleoside catabolic enzymes, are located contiguously in the order
C-A-B-D on the linkage map of E. coli. They constitute two overlapping operons,
one transcribing all the four genes and the other deoB and deoD. To the left of
deoC are located two promoter-operator regions in the order deoPO-cytPO. They
are involved in controlling the expression of the tetracistronic mRNA. For
efficient binding of RNA polymerase at the cytPO site the cAMP+CRP complex is
required, whereas binding of RNA polymerase at the deoPO site is independent of
this complex. Evidence is available for the existence of yet another controlling
site, PO-3, located between deoA and deoB; this controls the expression of deoB
and deoD. Both the operons are transcribed in a clockwise direction. An operator
constitutive (Oc) type mutant affecting the synthesis of all four deo enzymes
has been analysed. Because of this mutation the strain has become insensitive to
catabolite repression. The results confirm the order of the gene in the
controlling region to be deoPO-cytPO and the mutation, previously analysed as a
deletion, appears to have deleted cytPO deoC region of the chromosome.

PMID: 6780756 [PubMed - indexed for MEDLINE]

417: Mol Gen Genet. 1979 Nov;176(3):343-50. 

Involvement of cyclic AMP and its receptor protein in the sensitivity of
Escherichia coli K 12 toward serine: excretion of 2-ketobutyrate, a precursor of
isoleucine.

Daniel J, Danchin A.

A relationship between serine-induced growth sensitivity and the cAMP-CAP
complex is established. Mutants of Escherichia coli K 12 deficient either in the
cya or crp gene function exhibit a resistant phenotype on serine media although
they harbor a relA allele normally leading to sensitivity toward serine. The
presence of a crp allele in a cya delta relA background restores the sensitivity
phenotype, while the analysis of serine resistant mutants selected from a crp
cya delta relA strain shows that the mutation leading to resistance is located
at, or very near, the crp gene, giving a more or less Crp- phenotype. In
addition crp cya delta relA strains excrete large quantities of 2-ketobutyrate
when grown on glucose M63 medium. This excretion is unambiguously linked to the
presence of the crp allele and is correlated with an enhanced threonine
deaminase activity. Besides, the complex regulation exerted on the acetolactate
synthase activities is discussed.

PMID: 230407 [PubMed - indexed for MEDLINE]

418: J Bacteriol. 1979 Nov;140(2):369-76. 

Cyclic adenosine 3',5'-monophosphate regulation of the bacteriophage T6/colicin
K receptor in Escherichia coli.

Alderman EM, Dills SS, Melton T, Dobrogosz WJ.

Mutant strains of Escherichia coli unable to synthesize cyclic adenosine
3',5'-monophosphate (cAMP) or the cyclic adenosine monophosphate receptor
protein (CRP) were more resistant than wild-type cells to infection by
bacteriophage T6. This resistance was found to be associated with the decreased
production of specific T6 receptor protein (also the colicin K receptor) located
in the outer membrane protein fraction of these cells. Transcription of this
particular outer membrane protein was regulated by the cAMP-CRP complex. A novel
affinity technique coupled with sodium dodecyl sulfate-polyacrylamide gel
electrophoresis was used in these investigations.

PMID: 227838 [PubMed - indexed for MEDLINE]

419: Proc Natl Acad Sci U S A. 1979 Oct;76(10):5090-4. 

Interaction site of Escherichia coli cyclic AMP receptor protein on DNA of
galactose operon promoters.

Taniguchi T, O'Neill M, de Crombrugghe B.

Cyclic AMP (cAMP) and its receptor protein (CRP) have a dual role in the
regulation of the two promoters that control the galactose (gal) operon of
Escherichia coli. One promoter, P1, requires cAMP-CRP for activity; the other,
P2, is inhibited by these factors. We have examined the interactions site of
cAMP-CRP on gal DNA by using two types of protection experiments, involving
DNase digestion and methylation by dimethyl sulfate. Our results indicate that
cAMP-CRP binds to gal DNA in a segment located between 50 and 24 base pairs
preceding the P1 start point for transcription. Although the location of the
cAMP-CRP interaction site is clearly different in gal and lac DNA, comparison of
the DNA sequences suggests a similar recognition sequence. The location of the
cAMP . CRP-binding site in gal further suggests that protein-protein
interactions between RNA polymerase and cAMP . CRP play an important role in
transcription initiation at the gal and possibly other cAMP-dependent promoters.

PMID: 228278 [PubMed - indexed for MEDLINE]

420: Mol Gen Genet. 1978 Sep 20;165(1):47-56. 

The cyclic 3',5'-adenosine monophosphate receptor protein and regulation of
cyclic 3',5'-adenosine monophosphate synthesis in Escherichia coli.

Botsford JL, Drexler M.

Rates of synthesis of cyclic 3',5'-adenosine monophosphate (cAMP) were measured
in cultures of Escherichia coli aerating without a carbon source. This technique
provides a representative measure of adenylate cyclase activity in the absence
of inhibition caused by transport of the carbon source. Adenylate cyclase
activity was found to vary more than 20-fold depending on the carbon source that
had been available during growth. Synthesis of cAMP in cells aerating in the
absence of the carbon source was highest when cells had been grown with glucose
or fructose which inhibit adenylate cyclase activity severely. Synthesis of cAMP
was much lower when cells had been grown with glycerol or succinate which cause
only minimal inhibition of the activity. The variation in cAMP synthesis due to
different carbon sources requires a functional cAMP receptor protein (CRP). Crp-
mutants synthesize cAMP at comparable rates regardless of the carbon source that
afforded growth. A novel mutant of E. coli having a CRP no longer dependent on
cAMP has been isolated and characterized. Adenylate cyclase activity in this
mutant no longer responds normally to variations in the carbon source.

PMID: 213702 [PubMed - indexed for MEDLINE]

421: Eur J Biochem. 1978 Sep 1;89(2):483-90. 

Involvement of the Escherichia coli phosphoenolpyruvate-dependent
phosphotransferase system in regulation of transcription of catabolic genes.

Bolshakova TN, Gabrielyan TR, Bourd GI, Gershanovitch VN.

Synthesis of catabolite-sensitive enzymes is repressed in mutants defective in
the general proteins (enzyme I and HPr) of the Escherichia coli
phosphoenolpyruvate-dependent phosphotransferase system (ptsI and ptsH
mutations). To elucidate the mechanism of this phenomenon we constructed
isogenic strains carrying pts mutations as well as different lesions of
regulation of the lac operon or mutations affecting adenylate cyclase activity
(cya mutation) and synthesis of cyclic AMP-receptor protein (crp mutation)
Measurements of the differential rate of beta-galactosidase synthesis in these
strains showed that the repressive effect of pts mutations was revealed in lac+,
lacI, lacOc and cya bacteria, but it was lost in lacP and crp strains. It was
concluded that mutational damage to the general components of the
phosphoenolpyruvate-dependent phosphotransferase system diminishes activity of
the lac promoter. The results obtained led to the conclusion that pts gene
products (apparently phospho approximately HPr) are necessary for the initiation
of transcription of catabolite-sensitive operons in E. coli.

PMID: 101372 [PubMed - indexed for MEDLINE]

422: Mol Gen Genet. 1978 Jun 1;162(1):89-94. 

Catabolite modulator factor: physiological properties and in vivo effects.

Dessein A, Tillier F, Ullmann A.

Catabolite modulator factor (CMF) specifically inhibits the expression of
operons sensitive to catabolite repression. Systems known to be catabolite
independent are not affected by CMF. The rate of metabolism of CMF depends on
the extent of catabolite repression: it is slow under conditions of strong
repression and high in catabolically derepressed cells. Cyclic AMP does not
interfere with the rate of CMF metabolism. It has been found that a certain
class of crp mutants are partially resistant to the repressive effect of CMF.
Our results provide considerable support for the existence of an additional
negative control in the regulation of catabolite repression.

PMID: 209310 [PubMed - indexed for MEDLINE]

423: Mol Gen Genet. 1978 Jun 1;162(1):83-7. 

Catabolite repression in Escherichia coli mutants lacking cyclic AMP.

Dessein A, Schwartz M, Ullmann A.

The regulation of catabolite repression of beta-galactosidase has been studied
in Escherichia coli mutants deleted for the adenyl cyclase gene (cya delta), and
thus unable to synthesize cyclic AMP. It has been found that, provided a second
mutation occurs either in the crp gene coding for the catabolite gene activator
protein (CAP) or in the Lactose region, these mutants exhibit catabolite
repression.If the catabolite repression seen in the mutant strains corresponds
to the mechanism operating in wild-type cells the results would suggest that the
intracellular concentration of cyclic AMP cannot be the unique regulator of
catabolite repression.

PMID: 209309 [PubMed - indexed for MEDLINE]

424: Genetika. 1978;14(1):103-10. 

[Effect of mutations for adenylate cyclase (cya) and the cyclic adenosine
monophosphate receptor protein (cgp) on the gene expression of nucleoside
catabolism in Escherichia coli]

[Article in Russian]

Mironov AS, Sukhodolets VV, Alkhimova RA.

The effect of cya and crp mutations on the expression of the activity of
nucleoside catabolizing genes has been studied in Escherichia coli. It is found
that cya and crp mutants lose their ability to grow on nucleosides as carbon
sources in spite of the preservation of the basal levels of nucleoside
catabolizing enzymes, found in cell-free extracts of cya and crp mutants. It is
shown that cya and crp mutations completely release the influence of the
regulatory gene cytR on the activity of uridine phosphorylase (udp gene) and
thymidine phosphorylase (tpp gene). On this ground it is assumed that the cytR
gene product acts at the level of promotors of the corresponding structural
genes, causing their insensitivity to the positive action of cAMP--CRP complex.
The same data concerning the effect of cya and crp mutations on cytR regulation
have been reported [8], but these authors favoured the hypothesis that the cytR
gene product is a repressor protein, which binds to the specific operator.

PMID: 203511 [PubMed - indexed for MEDLINE]

425: J Bacteriol. 1977 Sep;131(3):854-65. 

Cyclic adenosine 3',5'-monophosphate regulation of membrane energetics in
Escherichia coli.

Dills SE, Dobrogosz WJ.

Mutants of Escherichia coli K-12 lacking functional adenylate cyclase (cya) or
the cyclic adenosine 3',5'-monophosphate (cAMP) receptor protein (crp) were
compared with their wild type to evaluate the role played by the cAMP-cAMP
receptor protein complex in regulating this organism's membrane-associated
bioenergetic functions. Both mutants were found to be equally defective in
carrying out various electron transport activities. In particular, their
capacity for synthesizing a functional oxygen-linked transhydrogenase system was
totally repressed, and their content of flavin adenine dinucleotide was reduced
by approximately 85%. In addition, it was found that the mutant strains had a
decreased ability to generate a protonmotive force and to use this chemiosmotic
force to generate adenosine 5'-triphosphate. All these membrane-associated
dysfunctions were completely restored to the wild-type state when the cya cells
were grown in the presence of exogenous cAMP. As would be expected if these
controls were operating at the transcriptional level, the crp cells retained the
mutant character even when grown in the presence of this cyclic nucleotide.

PMID: 19422 [PubMed - indexed for MEDLINE]

426: Mol Gen Genet. 1976 Oct 18;148(1):49-55. 

Multiple regulation of nucleoside catabolizing enzymes in Escherichia coli:
effects of 3:5' cyclic AMP and CRP protein.

Hammer-Jespersen K, Nygaard P.

The regulation of the synthesis of nucleoside metabolizing enzymes has been
studied in cya and crp mutant strains of Escherichia coli. The synthesis of the
cyt-enzymes, cytidine deaminase and uridine phosphorylase regulated by the cytR
gene product, is activated by the cAMP-CRP complex. On the other hand the
synthesis of the deoenzymes: deoxyriboaldolase, thymidine phosphorylase,
phosphodeoxyribomutase and purine nucleoside phosphorylase, appears to be
increased if an active cAMP-CRP complex cannot be formed. It also seems that
nucleosides serve as poor carbon sources for cya and crp mutants; this could not
solely be explained by low levels of nucleoside metabolizing enzymes nor by a
deficiency in nucleoside uptake. Addition of casamino acids stimulated the
growth of cya and crp mutants, with nucleosides as carbon sources. When grown on
glucose and casamino acids growth could be stimulated by adenine and
hypoxanthine nucleosides; these results suggest an impaired nitrogen metabolism
in cya and crp mutants.

PMID: 186698 [PubMed - indexed for MEDLINE]